[Biopython-dev] 5/6 BioStar - Biopython Questions

[Giovanni Marco Dall'Olio]

On Thu, May 6, 2010 at 8:08 AM, Feed My Inbox <updates at feedmyinbox.com> wrote:
> ==================================================
> 1. Simple Fasta Parsing Is Not Simple.
> ==================================================
> May 5, 2010 at 6:25 PM
>
> When trying out the examples from chapter 2.3 of the biopython 1.54b tutorial I keep running into this very annoying problem: When I use:

This user is complaining that the current biopython's tutorial
describes a feature introduced in biopython 1.54, so if you try it
with an earlier version, it doesn't work.
In particular, it is the feature that allow to use a string/filename
as argument for SeqIO.parse, which is not available in earlier
versions.
Maybe it would be useful to add a note to the tutorial, explaining
users that they should update biopython or that in earlier versions
they have to use a filehandler .


>
> from Bio import SeqIO
>
> for seq_record in SeqIO.parse("ls_orchid.fasta", "fasta"):
>
>    print seq_record.id
>    print repr(seq_record.seq)
>    print len(seq_record)
>
>
> ==================================================
> 2. How do I create a SeqRecord in biopython?
> ==================================================
> May 5, 2010 at 6:25 PM
>
> id1  ="HWI-EAS380:8:1:16:830/1"
>
> seq1 ="AGGGCGTTCAGCAGCCAGCTTGCGGCAAAACTGCGTAACCGTCTTCTCGTTCTCT
>       AAAAACCATTTTTCGTCCCCTTCGGGGCGGTGGTCTATAGTGTTATTAATATCAA
>       GTTGGGGGAGCACATTGTAGCATTG"
>
> qual1="abbbbbaab`abaabbaabaaaab^E^``^aaabaa_\_abaaaaaaaa`aaaa`
>       Z^`^^aaaaaaa`aa^aaa``_aa_aaaaaaaaaaa`aaaa`aaaaaabaaabba
>       aaaaaaaaaaa_baaaabbbbbaba"

Have a look at this question, too. I don't know how to answer properly.



-- 
Giovanni Dall'Olio, phd student
Department of Biologia Evolutiva at CEXS-UPF (Barcelona, Spain)

My blog on bioinformatics: http://bioinfoblog.it