[Biopython-dev] [Bug 2856] New: Duplicate positions for some restriction enzymes in some sequences

[bugzilla-daemon at portal.open-bio.org]

http://bugzilla.open-bio.org/show_bug.cgi?id=2856

           Summary: Duplicate positions for some restriction enzymes in some
                    sequences
           Product: Biopython
           Version: 1.50
          Platform: All
        OS/Version: All
            Status: NEW
          Severity: normal
          Priority: P2
         Component: Main Distribution
        AssignedTo: biopython-dev at biopython.org
        ReportedBy: zdmytriv at lbl.gov


Returns 2 identical positions for EcoRI enzyme in this sequence:
gaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccgga

Run this script test.py:
from Bio import SeqIO
from Bio.Restriction import *
from Bio.Seq import Seq
from Bio.Alphabet.IUPAC import IUPACAmbiguousDNA

if __name__ == "__main__":
    sequence = "gaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccgga"
    seq = Seq(sequence, IUPACAmbiguousDNA())
    analysis = Analysis([EcoRI], seq, linear=False)
    results =  analysis.full()

    for enzyme, positions in results.iteritems():
        if len(positions) == 0: continue

        print enzyme
        for position in positions:
            print position

# returns 2 items 2 and 2


-- 
Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?tab=email
------- You are receiving this mail because: -------
You are the assignee for the bug, or are watching the assignee.