[Biopython-dev] Bio.EZRetrieve appears to be obsolete or redunant

[Bruce Southey]

Hi,
The Bio.EZRetrieve module retrieves a single nucleotide sequence from 
EZRetrieve website:
http://siriusb.umdnj.edu:18080/EZRetrieve/single_r.jsp
It requires a human, rat or mouse nucleic GenBank, UniGene, LocusLink, 
or IMAGE ID. No other genomes are supported.

Although it appears faster than a Bio.GenBank query, I do not see that 
this module provides any special functionality than that already 
provided by Bio.GenBank and similar. So I think this module is obsolete 
and redundant.

Notes:
1) Obviously LocusLink has been superseded by Entrez Gene.
2) The documented genome builds are 2003 (eg human BUILD.34 at 11/04/2003) 
but not known if these have been updated since.
3) The start of the sequence is zero. You can use from_='start' instead 
but the can not mix it with numerical ending.
4) The actual website provides additional information including NCBI 
links (LocusLink and Nucleic) and does base counting.
5) There are other functions provided by the website like multiple 
retrievals.

The website example is for 'homeobox B6 [/Homo sapiens/]':

import Bio.EZRetrieve
seq=Bio.EZRetrieve.retrieve_single('BC014651', 1, 20)
print seq

Gives:
 >BC014651:HOXB6                        
ACCACACCTAGGTCGGAGCA

Bruce