[Biopython-dev] [Fwd: Question to code]

[Iddo Friedberg]

OK, I fixed that.

Eirik, you can check out a copy fom CVS, or wait for the Friday release.



./I


Frank Kauff wrote:

>Eirik,
>
>Try if the code works with
>
>b_results = NCBIWWW.qblast('blastn', 'nr', f_record).read()
>
>instead of 
>
>  
>
>>b_results = NCBIWWW.blast('blastn', 'nr', f_record).read()
>>
>>    
>>
>
>I think that issue appeared a couple of months ago on the biopython list, essentially saying that
>qblast is the blast NCBI wants people to use for blast scripts? After that, qblast method was added
>to NCBIWWW, and it's what I'm using in my blast scripts.
>
>Hope this helps,
>Frank
>
>On Wed, 2005-02-16 at 14:02 -0800, Iddo Friedberg wrote:
>  
>
>>OK, this is a real bug. NCBIWWW seems to be broken.
>>
>>I'm having a looksee, but I'd like someone more versed in this than me 
>>to do so.
>>
>>Thanks,
>>
>>Iddo
>>
>>
>>
>>-------- Original Message --------
>>Subject: 	Question to code
>>Date: 	Wed, 16 Feb 2005 15:19:57 +0100
>>From: 	Eirik Sønneland <eirik.sonneland at student.umb.no>
>>To: 	idoerg
>>
>>
>>
>>Dear Freidberg,
>>
>>I've been having problems parsing my output from NCBI using the example 
>>code given in Biopython Cookbook. Therefore I tried to follow your code 
>>described in "Genome Informatics 14(2003). Still I get an error message 
>>connected to the parsing. Could you please give a hint on what is wrong? 
>>Is this a bug?? Code and output as follows:
>>
>>Code:
>>
>>from Bio.Blast import NCBIWWW
>>from Bio import Fasta
>>
>>file_for_blast = open('Fastaformat.txt', 'r')
>>f_iterator = Fasta.Iterator(file_for_blast)
>>f_record = f_iterator.next()
>>
>>b_results = NCBIWWW.blast('blastn', 'nr', f_record).read()
>>
>>b_record = NCBIWWW.BlastParser().parse_str(b_results)
>>
>>Output(Have cut out the beginning, only pasted the last part of output):
>>
>>
>> Score = 40.1 bits (20), Expect = 6.3
>> Identities = 20/20 (100%)
>> Strand = Plus / Minus
>>
>>                                 
>>Query: 29     ctgcagctcgggctcctgcc 48
>>              ||||||||||||||||||||
>>Sbjct: 150928 ctgcagctcgggctcctgcc 150909
>></PRE>
>>
>>
>><form>
>>
>><PRE>
>>Lambda     K      H
>>    1.37    0.711     1.31
>>
>>Gapped
>>Lambda     K      H
>>    1.37    0.711     1.31
>>
>>Matrix: blastn matrix:1 -3
>>Gap Penalties: Existence: 5, Extension: 2
>>Number of Sequences: 2894376
>>Number of Hits to DB: 6,089,259
>>Number of extensions: 328661
>>Number of successful extensions: 6259
>>Number of sequences better than 10.0: 2
>>Number of HSP's better than 10.0 without gapping: 2
>>Number of HSP's gapped: 6259
>>Number of HSP's successfully gapped: 2
>>Number of extra gapped extensions for HSPs above 10.0: 6255
>>Length of query: 600
>>Length of database: 13,294,103,689
>>Length adjustment: 22
>>Effective length of query: 578
>>Effective length of database: 13,230,427,417
>>Effective search space: 7647187047026
>>Effective search space used: 7647187047026
>>A: 0
>>X1: 11 (21.8 bits)
>>X2: 15 (30.0 bits)
>>X3: 25 (50.0 bits)
>>S1: 14 (25.0 bits)
>>S2: 20 (40.1 bits)
>>
>>
>></form>
>>
>>Traceback (most recent call last):
>>  File "C:\Python24\MyWorkspace.py", line 50, in -toplevel-
>>    b_record = NCBIWWW.BlastParser().parse_str(b_results)
>>  File "C:\Python24\Lib\site-packages\Bio\ParserSupport.py", line 52, in 
>>parse_str
>>    return self.parse(File.StringHandle(string))
>>  File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 47, in 
>>parse
>>    self._scanner.feed(handle, self._consumer)
>>  File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 99, in 
>>feed
>>    self._scan_rounds(uhandle, consumer)
>>  File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 242, 
>>in _scan_rounds
>>    self._scan_alignments(uhandle, consumer)
>>  File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 322, 
>>in _scan_alignments
>>    raise SyntaxError, "Cannot resolve location at line:\n%s" % line1
>>SyntaxError: Cannot resolve location at line:
>></form>
>>
>> >>>
>>
>>Thanks!
>>
>>Regards,
>>Eirik
>>
>>
>>    
>>


-- 
Iddo Friedberg, Ph.D.
The Burnham Institute
10901 N. Torrey Pines Rd.
La Jolla, CA 92037 USA
Tel: +1 (858) 646 3100 x3516
Fax: +1 (858) 713 9930
http://ffas.ljcrf.edu/~iddo
==========================
The First Automated Protein Function Prediction SIG
Detroit, MI June 24, 2005
http://ffas.burnham.org/AFP