[Biopython-dev] [Bug 1774] New: Bio.Clustalw: bug in computing the alignment.

[bugzilla-daemon at portal.open-bio.org]

http://bugzilla.open-bio.org/show_bug.cgi?id=1774

           Summary: Bio.Clustalw: bug in computing the alignment.
           Product: Biopython
           Version: Not Applicable
          Platform: PC
        OS/Version: Linux
            Status: NEW
          Severity: normal
          Priority: P2
         Component: Main Distribution
        AssignedTo: biopython-dev at biopython.org
        ReportedBy: crober at scri.ac.uk


Using Bio.Clustalw in order to process a sequence alignment, there is a bug in
computing the alignment when in the input file more than one sequence 
has the same name. This bug is not reported by Bio.Clustalw if the output file
you specify already exists. In that latter case, Bio.Clustalw will 
just read the results from the output file rather than reporting the error.


#------- program.py
#! /usr/bin/python2.4
import sys
from Bio import Clustalw
from Bio.Clustalw import MultipleAlignCL
import sys

cline = MultipleAlignCL(sys.argv[1])
cline.set_output(sys.argv[2])
align = Bio.Clustalw.do_alignment(cline)

#---------- input.fas
>Putative binding site
ggaacggatgctcgcccagttccaccaacg
>Putative binding site
ggaacccatccttttctgcgtccacacagc
>Putative promoter inside
ggaacaggtgtttcgtcaacacgga
>Putative binding site
ggaacaaacacaactactgcactat

#------- command line to start creating the alignment
$ python2.4 program.py input.fas output.fas

#-------- ERROR MESSAGE when running clustalw as follows:
$ clustalw input.fas -outfile=output.fas
ERROR: Multiple sequences found with same name, Putative (first 30 chars are
significant)
No. of seqs. read = 0. No alignment!



------- You are receiving this mail because: -------
You are the assignee for the bug, or are watching the assignee.