[Biopython-dev] Error in tutorial program
abc at palantir.chem.emory.edu
abc at palantir.chem.emory.edu
Fri Oct 18 08:01:39 EDT 2002
Hi,
I've been working through the Tutorial document and I noticed that the
Cypripedioideae FASTA parsing example is somewhat broken. The
Doc/examples/fasta_consumer.py script works if you use the
ls_orchid.fasta file from the same directory. However, if you do your own
Entrez search and run the script on it you will get an error like this:
Traceback (most recent call last):
File "./x.py", line 32, in ?
extract_organisms('/home/abc/x.fasta', 95)
File "./x.py", line 27, in extract_organisms
scanner.feed(file_to_parse, consumer)
File "/usr/local/lib/python2.2/site-packages/Bio/Fasta/__init__.py", line 225, in feed
self._scan_record(uhandle, consumer)
File "/usr/local/lib/python2.2/site-packages/Bio/Fasta/__init__.py", line 229, in _scan_record
self._scan_title(uhandle, consumer)
File "/usr/local/lib/python2.2/site-packages/Bio/Fasta/__init__.py", line 234, in _scan_title
read_and_call(uhandle, consumer.title, start='>')
File "/usr/local/lib/python2.2/site-packages/Bio/ParserSupport.py", line 331, in read_and_call
raise SyntaxError, errmsg
SyntaxError: Line does not start with '>':
TCAGCGGTGGCTCACTGACTGGGTTGCATCCAAGTGGCCGTCACCGCCCATGGGGTTGACGTGCCTCCAA
The problem occurs because the individual records in the search output that I
get aren't separated by newlines like the ones in ls_orchid.fasta. The
Bio.Fasta._Scanner class can't handle this format unless the file handle you
pass to it implements the `saveline' method (even though it doesn't say this).
fasta_consumer.py just passes a regular python file object.
Below are a couple of simple fixes. The _Scanner patch potentially breaks
existing code, so maybe it's not so good.
Regards,
Ben
--- Doc/examples/fasta_consumer.py 2001/02/01 05:45:28 1.3
+++ Doc/examples/fasta_consumer.py 2002/10/17 15:31:36
@@ -1,6 +1,8 @@
from Bio.ParserSupport import AbstractConsumer
from Bio import Fasta
+from Bio.File import UndoHandle
+
import string
class SpeciesExtractor(AbstractConsumer):
@@ -19,9 +21,9 @@
def extract_organisms(file, num_records):
scanner = Fasta._Scanner()
consumer = SpeciesExtractor()
-
- file_to_parse = open(file, 'r')
+ file_to_parse = UndoHandle(open(file, 'r'))
+
for fasta_record in range(num_records):
scanner.feed(file_to_parse, consumer)
--- Bio/Fasta/__init__.py 2001/07/05 23:56:49 1.4
+++ Bio/Fasta/__init__.py 2002/10/17 15:30:47
@@ -211,15 +211,12 @@
def feed(self, handle, consumer):
"""feed(self, handle, consumer)
- Feed in FASTA data for scanning. handle is a file-like object
- containing FASTA data. consumer is a Consumer object that will
- receive events as the FASTA data is scanned.
+ Feed in FASTA data for scanning. handle is an instance of
+ File.UndoHandle containing FASTA data. consumer is a Consumer
+ object that will receive events as the FASTA data is scanned.
"""
- if isinstance(handle, File.UndoHandle):
- uhandle = handle
- else:
- uhandle = File.UndoHandle(handle)
+ assert isinstance(handle, File.UndoHandle):
if uhandle.peekline():
self._scan_record(uhandle, consumer)
More information about the Biopython-dev
mailing list