Running make test PERL_DL_NONLAZY=1 /usr/bin/perl "-MExtUtils::Command::MM" "-e" "test_harness(0, 'blib/lib', 'blib/arch')" t/*.t t/AAChange...................ok t/AAReverseMutate............ok t/AlignIO....................ok t/AlignStats.................ok t/Allele.....................ok t/Alphabet...................ok t/Annotation.................ok t/AnnotationAdaptor..........ok t/Assembly...................ok t/Biblio.....................ok t/Biblio_biofetch............ok t/BiblioReferences...........ok t/BioDBGFF...................ok t/BioFetch_DB................FAILED test 8 Failed 1/27 tests, 96.30% okay t/BioGraphics................ok t/BlastIndex.................ok t/BPbl2seq...................ok t/BPlite.....................ok t/BPpsilite..................ok t/Chain......................ok t/cigarstring................ok t/ClusterIO..................ok t/Coalescent.................ok t/CodonTable.................ok t/consed.....................ok t/CoordinateGraph............ok t/CoordinateMapper...........ok t/Correlate..................ok t/CytoMap....................ok t/DB.........................ok t/DBCUTG.....................ok t/DBFasta....................ok t/DNAMutation................ok t/Domcut.....................ok t/ECnumber...................ok t/ELM........................ok 1/14 -------------------- WARNING --------------------- MSG: Bio::Tools::Analysis::Protein::ELM Request Error: 400 URL must be absolute Content-Type: text/plain Client-Date: Mon, 13 Nov 2006 17:54:55 GMT Client-Warning: Internal response 400 URL must be absolute --------------------------------------------------- t/ELM........................ok t/EMBL_DB....................FAILED tests 6, 13-14 Failed 3/15 tests, 80.00% okay t/EMBOSS_Tools...............ok t/EncodedSeq.................ok t/ePCR.......................ok t/ESEfinder..................ok t/est2genome.................ok t/Exception..................ok t/Exonerate..................ok t/flat.......................ok t/FootPrinter................ok t/game.......................ok t/GDB........................ok t/GeneCoordinateMapper.......ok 1/113 -------------------- WARNING --------------------- MSG: sorted sublocation array requested but root location doesn't define seq_id (at least one sublocation does!) --------------------------------------------------- -------------------- WARNING --------------------- MSG: sorted sublocation array requested but root location doesn't define seq_id (at least one sublocation does!) --------------------------------------------------- Use of uninitialized value in concatenation (.) or string at /private/var/root/.cpan/build/bioperl-1.4/blib/lib/Bio/Coordinate/GeneMapper.pm line 814. t/GeneCoordinateMapper.......ok t/Geneid.....................ok t/Genewise...................ok 2/51 skipped: t/Genomewise.................ok t/Genpred....................ok t/GFF........................ok 1/32Filehandle GEN0 opened only for output at /private/var/root/.cpan/build/bioperl-1.4/blib/lib/Bio/Root/IO.pm line 440. Filehandle GEN1 opened only for output at /private/var/root/.cpan/build/bioperl-1.4/blib/lib/Bio/Root/IO.pm line 440. t/GFF........................ok t/GOR4.......................ok t/GOterm.....................ok t/GuessSeqFormat.............ok t/hmmer......................ok t/HNN........................ok t/Index......................ok t/InstanceSite...............ok t/InterProParser.............ok t/IUPAC......................ok t/largefasta.................ok t/largepseq..................ok t/LinkageMap.................ok t/LiveSeq....................ok t/LocatableSeq...............ok t/Location...................ok t/LocationFactory............ok t/LocusLink..................ok t/lucy.......................ok t/Map........................ok t/MapIO......................ok t/Matrix.....................ok t/Measure....................ok t/MeSH.......................ok t/MetaSeq....................ok t/MicrosatelliteMarker.......ok t/MiniMIMentry...............ok t/MitoProt...................ok t/Molphy.....................ok t/multiple_fasta.............ok t/Mutation...................ok t/Mutator....................ok t/NetPhos....................ok t/Node.......................ok t/OddCodes...................ok t/OMIMentry..................ok t/OMIMentryAllelicVariant....ok t/OMIMparser.................ok t/Ontology...................set_attribute: not a compat02 graph at /Library/Perl/5.8.6/Graph.pm line 2381, line 10. t/Ontology...................dubious Test returned status 255 (wstat 65280, 0xff00) DIED. FAILED tests 1-50 Failed 50/50 tests, 0.00% okay t/OntologyEngine.............ok t/PAML.......................ok t/Perl.......................ok t/phd........................ok t/Phenotype..................ok t/PhylipDist.................ok t/pICalculator...............ok t/Pictogram..................ok t/PopGen.....................ok t/PopGenSims.................ok t/primaryqual................ok t/PrimarySeq.................ok t/primedseq..................ok t/Primer.....................ok t/primer3....................ok t/Promoterwise...............ok t/ProtDist...................ok t/psm........................ok t/QRNA.......................ok t/qual.......................ok t/RandDistFunctions..........ok t/RandomTreeFactory..........ok t/Range......................ok t/RangeI.....................ok t/RefSeq.....................ok t/Registry...................ok t/Relationship...............ok t/RelationshipType...........ok t/RemoteBlast................ok 4/6 skipped: to avoid timeout t/RepeatMasker...............ok t/RestrictionAnalysis........ok t/RestrictionEnzyme..........ok t/RestrictionIO..............ok t/RNAChange..................ok t/RootI......................ok t/RootIO.....................ok t/RootStorable...............ok t/Scansite...................ok t/scf........................ok t/SearchDist.................ok t/SearchIO...................ok t/Seq........................ok t/SeqAnalysisParser..........ok t/SeqBuilder.................ok t/SeqDiff....................ok t/SeqFeatCollection..........ok t/SeqFeature.................ok t/seqfeaturePrimer...........ok t/SeqIO......................ok 3/235 skipped: t/SeqPattern.................ok t/SeqStats...................ok t/SequenceFamily.............ok t/sequencetrace..............ok t/SeqUtils...................ok t/seqwithquality.............ok t/SeqWords...................ok t/Sigcleave..................ok t/Sim4.......................ok t/SimilarityPair.............ok t/SimpleAlign................ok t/simpleGOparser.............set_attribute: not a compat02 graph at /Library/Perl/5.8.6/Graph.pm line 2381, line 14. t/simpleGOparser.............dubious Test returned status 255 (wstat 65280, 0xff00) DIED. FAILED tests 1-98 Failed 98/98 tests, 0.00% okay t/sirna......................ok t/SiteMatrix.................ok t/SNP........................ok t/Sopma......................ok t/Species....................ok t/splicedseq.................ok t/StandAloneBlast............ok t/StructIO...................ok t/Structure..................ok t/Swiss......................ok t/Symbol.....................ok t/Taxonomy...................ok 7/8 skipped: to avoid blocking t/Tempfile...................ok t/Term.......................ok t/Tools......................ok t/Tree.......................ok t/TreeIO.....................FAILED test 42 Failed 1/41 tests, 97.56% okay t/trim.......................ok t/tutorial...................ok 17/21Use of uninitialized value in print at /private/var/root/.cpan/build/bioperl-1.4/blib/lib/bptutorial.pl line 4042, line 934. t/tutorial...................ok t/UCSCParsers................ok t/Unflattener................ok t/Unflattener2...............ok t/UniGene....................ok t/Variation_IO...............NOK 151d0 < 32d30 < 60d57 < 91d87 < 121d116 < 152d146 < 183d176 < 214d206 < 245d236 < 268d258 < 291d280 < 315d303 < 347d334 < 379d365 < t/Variation_IO...............NOK 201d0 < t/Variation_IO...............NOK 251,350c1,388 < ID M20132:(362)c.+4G>A; E2K < Feature DNA; 1 < Feature /label: point, transition < Feature /proof: computed < Feature /location: 4 < Feature /upflank: gaagattcagccaagctcaaggatg < Feature /change: g>a < Feature /dnflank: aagtgcagttagggctgggaagggt < Feature /re_site: -BccI < Feature RNA; 1 < Feature /label: missense < Feature /proof: experimental < Feature /location: 4 (M20132::366) < Feature /upflank: gaagattcagccaagctcaaggatg < Feature /change: g>a < Feature /dnflank: aagtgcagttagggctgggaagggt < Feature /re_site: -BccI < Feature /codon_table: 1 < Feature /codon: gaa>aaa; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: substitution, conservative < Feature /proof: computed < Feature /location: 2 < Feature /change: E>K < // < ID M20132:(362)c.+14T>A; L5X < Feature DNA; 1 < Feature /label: point, transversion < Feature /proof: computed < Feature /location: 14 < Feature /upflank: ccaagctcaaggatggaagtgcagt < Feature /change: t>a < Feature /dnflank: agggctgggaagggtctaccctcgg < Feature RNA; 1 < Feature /label: nonsense < Feature /proof: experimental < Feature /location: 14 (M20132::376) < Feature /upflank: ccaagctcaaggatggaagtgcagt < Feature /change: t>a < Feature /dnflank: agggctgggaagggtctaccctcgg < Feature /codon_table: 1 < Feature /codon: tta>taa; 2 < Feature /region: coding < Feature AA; 1 < Feature /label: truncation < Feature /proof: computed < Feature /location: 5 < Feature /change: L>* < // < ID M20132:(362)c.+4G>A; E2K < Feature DNA; 1 < Feature /label: point, transition < Feature /proof: computed < Feature /location: 4 < Feature /upflank: gaagattcagccaagctcaaggatg < Feature /change: g>a < Feature /dnflank: aagtgcagttagggctgggaagggt < Feature /re_site: -BccI < Feature RNA; 1 < Feature /label: missense < Feature /proof: experimental < Feature /location: 4 (M20132::366) < Feature /upflank: gaagattcagccaagctcaaggatg < Feature /change: g>a < Feature /dnflank: aagtgcagttagggctgggaagggt < Feature /re_site: -BccI < Feature /codon_table: 1 < Feature /codon: gaa>aaa; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: substitution, conservative < Feature /proof: computed < Feature /location: 2 < Feature /change: E>K < // < ID M20132:(362)c.+100delATCCAG; I34del-2 < Feature DNA; 1 < Feature /label: deletion < Feature /proof: computed < Feature /location: 100..105 < Feature /upflank: tctgttccagagcgtgcgcgaagtg < Feature /change: atccag> < Feature /dnflank: aacccgggccccaggcacccagagg < Feature /re_site: -BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, +MjaIV < Feature RNA; 1 < Feature /label: inframe, deletion < Feature /proof: experimental < Feature /location: 100..105 (M20132::462..467) < Feature /upflank: tctgttccagagcgtgcgcgaagtg < Feature /change: atccag> < Feature /dnflank: aacccgggccccaggcacccagagg < Feature /re_site: -BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, +MjaIV < Feature /codon_table: 1 < Feature /codon: atc>-; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: deletion < Feature /proof: computed < Feature /location: 34..35 < Feature /change: IQ> < // < ID M20132:(362)c.+101delT; I34delX172 < Feature DNA; 1 < Feature /label: deletion < Feature /proof: computed < Feature /location: 101 < Feature /upflank: ctgttccagagcgtgcgcgaagtga < Feature /change: t> < Feature /dnflank: ccagaacccgggccccaggcaccca < Feature /re_site: -BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, +Tsp45I < Feature RNA; 1 < Feature /label: frameshift, deletion < Feature /proof: experimental < Feature /location: 101 (M20132::463) < Feature /upflank: ctgttccagagcgtgcgcgaagtga < Feature /change: t> < Feature /dnflank: ccagaacccgggccccaggcaccca < Feature /re_site: -BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, +Tsp45I < Feature /codon_table: 1 < Feature /codon: atc>-; 2 < Feature /region: coding < Feature AA; 1 < Feature /label: out-of-frame translation, truncation < Feature /proof: computed < Feature /location: 34 < Feature /change: I>TRTRAPGTQRPRAQHLPAPVCCCCSSSSSSSSSSSSSSSSSSSSKRLAP < Feature GSSSSSRVRMVLPKPIVEAPQATWSWMRNSNLHSRSRPWSATPREVASQSLEPPWPPAR < Feature GCRSSCQHLRTRMTQLPHPRCPCWAPLSPA* < // < ID M20132:(362)c.+101insGGGCCC; I34ins+2 < Feature DNA; 1 < Feature /label: insertion < Feature /proof: computed < Feature /location: 100^101 < Feature /upflank: ctgttccagagcgtgcgcgaagtga < Feature /change: >gggccc < Feature /dnflank: tccagaacccgggccccaggcaccc < Feature /re_site: +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, < Feature +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, < Feature +SduI < Feature RNA; 1 < Feature /label: inframe, insertion < Feature /proof: experimental < Feature /location: 100^101 (M20132::462^463) < Feature /upflank: ctgttccagagcgtgcgcgaagtga < Feature /change: >gggccc < Feature /dnflank: tccagaacccgggccccaggcaccc < Feature /re_site: +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, < Feature +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, < Feature +SduI < Feature /codon_table: 1 < Feature /codon: atc>-; 2 < Feature /region: coding < Feature AA; 1 < Feature /label: insertion, complex < Feature /proof: computed < Feature /location: 34 < Feature /change: I>RAL < // < ID M20132:(362)c.+100insG; I34ins81X < Feature DNA; 1 < Feature /label: insertion < Feature /proof: computed < Feature /location: 99^100 < Feature /upflank: tctgttccagagcgtgcgcgaagtg < Feature /change: >g < Feature /dnflank: atccagaacccgggccccaggcacc < Feature /re_site: +BamHI, +BinI, +NlaIV, +XhoII < Feature RNA; 1 < Feature /label: frameshift, insertion < Feature /proof: experimental < Feature /location: 99^100 (M20132::461^462) < Feature /upflank: tctgttccagagcgtgcgcgaagtg < Feature /change: >g < Feature /dnflank: atccagaacccgggccccaggcacc < Feature /re_site: +BamHI, +BinI, +NlaIV, +XhoII < Feature /codon_table: 1 < Feature /codon: atc>-; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: out-of-frame translation, truncation < Feature /proof: computed < Feature /location: 34 < Feature /change: I>DPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD* < // < ID M20132:(362)c.+100AT>GGGCCC; I34ins82X < Feature DNA; 1 < Feature /label: complex < Feature /proof: computed < Feature /location: 100..101 < Feature /upflank: tctgttccagagcgtgcgcgaagtg < Feature /change: at>gggccc < Feature /dnflank: ccagaacccgggccccaggcaccca < Feature /re_site: +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, < Feature +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, +SduI < Feature RNA; 1 < Feature /label: frameshift, complex < Feature /proof: experimental < Feature /location: 100..101 (M20132::462..463) < Feature /upflank: tctgttccagagcgtgcgcgaagtg < Feature /change: at>gggccc < Feature /dnflank: ccagaacccgggccccaggcaccca < Feature /re_site: +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, < Feature +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, +SduI < Feature /codon_table: 1 < Feature /codon: atc>-; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: out-of-frame translation, truncation < Feature /proof: computed < Feature /location: 34 < Feature /change: I>GPPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD* < // < ID M20132:(362+1)c.-1G>A < Feature DNA; 1 < Feature /label: point, transition < Feature /proof: computed < Feature /location: -1 < Feature /upflank: ggtggaagattcagccaagctcaag < Feature /change: g>a < Feature /dnflank: atggaagtgcagttagggctgggaa < Feature /re_site: -BccI, -FokI, +Hpy178III < Feature RNA; 1 < Feature /label: unknown < Feature /proof: experimental < Feature /location: -1 (M20132::361) < Feature /upflank: ggtggaagattcagccaagctcaag < Feature /change: g>a < Feature /dnflank: atggaagtgcagttagggctgggaa < Feature /re_site: -BccI, -FokI, +Hpy178III < Feature /region: 5'UTR < // < ID M20132:(362)c.+2766T>C < Feature DNA; 1 < Feature /label: point, transition < Feature /proof: computed < Feature /location: 2766 < Feature /upflank: tctatttccacacccagtgaagcat < Feature /change: t>c < Feature /dnflank: ggaaaccctatttccccaccccagc < Feature /re_site: +Hpy188I, +SfaNI, -XcmI < Feature RNA; 1 < Feature /label: unknown < Feature /proof: experimental < Feature /location: 2766 (M20132::3128) < Feature /upflank: tctatttccacacccagtgaagcat < Feature /change: t>c < Feature /dnflank: ggaaaccctatttccccaccccagc < Feature /re_site: +Hpy188I, +SfaNI, -XcmI < Feature /region: 3'UTR < // < ID J02933:(521)g.+12165A>G < Feature DNA; 1 < Feature /label: point, transition < Feature /proof: experimental < Feature /location: 12165 (J02933::12686) < Feature /upflank: cgcacacctgtggtgcctgccaccc < Feature /change: a>g < Feature /dnflank: ctgggttgcccatgattcatttttg < Feature /re_site: +AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, < Feature -TspRI < Feature /region: 3'UTR; (+1027) < Feature RNA; 1 < Feature /label: unknown < Feature /proof: computed < Feature /location: 2428 < Feature /upflank: cgcacacctgtggtgcctgccaccc < Feature /change: a>g < Feature /dnflank: ctgggttgcccatgattcatttttg < Feature /re_site: +AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, < Feature -TspRI < Feature /region: 3'UTR; (-1) < // < ID J02933:(521)g.+4G>T; V2F < Feature DNA; 1 < Feature /label: point, transversion < Feature /proof: computed < Feature /location: 4 (J02933::525) < Feature /upflank: gcagcactgcagagatttcatcatg < Feature /change: g>t < Feature /dnflank: tctcccaggccctcaggctcctctg < Feature /re_site: -BsmAI, -Eco31I < Feature /region: exon; 1 (+4) < Feature RNA; 1 < Feature /label: missense < Feature /proof: experimental < Feature /location: 4 < Feature /upflank: gcagcactgcagagatttcatcatg < Feature /change: g>t < Feature /dnflank: tctcccaggccctcaggctcctctg < Feature /re_site: -BsmAI, -Eco31I < Feature /codon_table: 1 < Feature /codon: gtc>ttc; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: substitution, nonconservative < Feature /proof: computed < Feature /location: 2 < Feature /change: V>F < // < ID J02933:(521)g.+1168G>T; D34Y < Feature DNA; 1 < Feature /label: point, transversion < Feature /proof: computed < Feature /location: 1168 (J02933::1689) < Feature /upflank: taaggcctcaggaggagaaacacgg < Feature /change: g>t < Feature /dnflank: acatgccgtggaagccggggcctca < Feature /re_site: -BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, < Feature +Tsp4CI < Feature /region: exon; 1 (-29) < Feature RNA; 1 < Feature /label: missense < Feature /proof: experimental < Feature /location: 100 < Feature /upflank: taaggcctcaggaggagaaacacgg < Feature /change: g>t < Feature /dnflank: acatgccgtggaagccggggcctca < Feature /re_site: -BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, < Feature +Tsp4CI < Feature /codon_table: 1 < Feature /codon: gac>tac; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: substitution, nonconservative < Feature /proof: computed < Feature /location: 34 < Feature /change: D>Y < // < ID J02933:(521+1)g.-4C>G < Feature DNA; 1 < Feature /label: point, transversion < Feature /proof: computed < Feature /location: -4 (J02933::518) < Feature /upflank: ggcaggggcagcactgcagagattt < Feature /change: c>g < Feature /dnflank: atcatggtctcccaggccctcaggc < Feature /re_site: +BclI, +DpnI, +MboI < Feature /region: 5'UTR; (-4) < Feature RNA; 1 < Feature /label: unknown < Feature /proof: experimental < Feature /location: -4 < Feature /upflank: ggcaggggcagcactgcagagattt < Feature /change: c>g < Feature /dnflank: atcatggtctcccaggccctcaggc < Feature /re_site: +BclI, +DpnI, +MboI < Feature /region: 5'UTR; (+31) < // --- > > > > > computed > gaagattcagccaagctcaaggatg > g > a > aagtgcagttagggctgggaagggt > -BccI > > > > experimental > gaagattcagccaagctcaaggatg > g > a > aagtgcagttagggctgggaagggt > > -BccI > coding > > > > > computed > E > K > > > > > > > computed > ccaagctcaaggatggaagtgcagt > t > a > agggctgggaagggtctaccctcgg > > > > experimental > ccaagctcaaggatggaagtgcagt > t > a > agggctgggaagggtctaccctcgg > > coding > > > > computed > L > * > > > > > > > computed > gaagattcagccaagctcaaggatg > g > a > aagtgcagttagggctgggaagggt > -BccI > > > > experimental > gaagattcagccaagctcaaggatg > g > a > aagtgcagttagggctgggaagggt > > -BccI > coding > > > > > computed > E > K > > > > > > computed > tctgttccagagcgtgcgcgaagtg > atccag > > aacccgggccccaggcacccagagg > -BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, +MjaIV > > > > > experimental > tctgttccagagcgtgcgcgaagtg > atccag > > aacccgggccccaggcacccagagg > > -BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, +MjaIV > coding > > > > computed > IQ > > > > > > > computed > ctgttccagagcgtgcgcgaagtga > t > > ccagaacccgggccccaggcaccca > -BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, +Tsp45I > > > > > experimental > ctgttccagagcgtgcgcgaagtga > t > > ccagaacccgggccccaggcaccca > > -BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, +Tsp45I > coding > > > > > computed > I > TRTRAPGTQRPRAQHLPAPVCCCCSSSSSSSSSSSSSSSSSSSSKRLAPGSSSSSRVRMVLPKPIVEAPQATWSWMRNSNLHSRSRPWSATPREVASQSLEPPWPPARGCRSSCQHLRTRMTQLPHPRCPCWAPLSPA* > > > > > > computed > ctgttccagagcgtgcgcgaagtga > > gggccc > tccagaacccgggccccaggcaccc > +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, +SduI > > > > > experimental > ctgttccagagcgtgcgcgaagtga > > gggccc > tccagaacccgggccccaggcaccc > > +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, +SduI > coding > > > > > computed > I > RAL > > > > > > computed > tctgttccagagcgtgcgcgaagtg > > g > atccagaacccgggccccaggcacc > +BamHI, +BinI, +NlaIV, +XhoII > > > > > experimental > tctgttccagagcgtgcgcgaagtg > > g > atccagaacccgggccccaggcacc > > +BamHI, +BinI, +NlaIV, +XhoII > coding > > > > > computed > I > DPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD* > > > > > > computed > tctgttccagagcgtgcgcgaagtg > at > gggccc > ccagaacccgggccccaggcaccca > +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, +SduI > > > > > experimental > tctgttccagagcgtgcgcgaagtg > at > gggccc > ccagaacccgggccccaggcaccca > > +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, +SduI > coding > > > > > computed > I > GPPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD* > > > > > > > computed > ggtggaagattcagccaagctcaag > g > a > atggaagtgcagttagggctgggaa > -BccI, -FokI, +Hpy178III > > > > experimental > ggtggaagattcagccaagctcaag > g > a > atggaagtgcagttagggctgggaa > -BccI, -FokI, +Hpy178III > 5'UTR > > > > > > > computed > tctatttccacacccagtgaagcat > t > c > ggaaaccctatttccccaccccagc > +Hpy188I, +SfaNI, -XcmI > > > > experimental > tctatttccacacccagtgaagcat > t > c > ggaaaccctatttccccaccccagc > +Hpy188I, +SfaNI, -XcmI > 3'UTR > > > > > > > experimental > cgcacacctgtggtgcctgccaccc > a > g > ctgggttgcccatgattcatttttg > +AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, -TspRI > 3'UTR > > > > computed > cgcacacctgtggtgcctgccaccc > a > g > ctgggttgcccatgattcatttttg > +AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, -TspRI > 3'UTR > > > > > > > computed > gcagcactgcagagatttcatcatg > g > t > tctcccaggccctcaggctcctctg > -BsmAI, -Eco31I > exon > > > > experimental > gcagcactgcagagatttcatcatg > g > t > tctcccaggccctcaggctcctctg > > -BsmAI, -Eco31I > coding > > > > > computed > V > F > > > > > > > computed > taaggcctcaggaggagaaacacgg > g > t > acatgccgtggaagccggggcctca > -BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, +Tsp4CI > exon > > > > experimental > taaggcctcaggaggagaaacacgg > g > t > acatgccgtggaagccggggcctca > > -BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, +Tsp4CI > coding > > > > > computed > D > Y > > > > > > > computed > ggcaggggcagcactgcagagattt > c > g > atcatggtctcccaggccctcaggc > +BclI, +DpnI, +MboI > 5'UTR > > > > experimental > ggcaggggcagcactgcagagattt > c > g > atcatggtctcccaggccctcaggc > +BclI, +DpnI, +MboI > 5'UTR > > t/Variation_IO...............FAILED tests 15, 20, 25 Failed 3/25 tests, 88.00% okay t/WABA.......................ok t/XEMBL_DB...................ok Failed Test Stat Wstat Total Fail List of Failed ------------------------------------------------------------------------------- t/BioFetch_DB.t 27 1 8 t/EMBL_DB.t 15 3 6 13-14 t/Ontology.t 255 65280 50 100 1-50 t/TreeIO.t 41 1 42 t/Variation_IO.t 25 3 15 20 25 t/simpleGOparser.t 255 65280 98 196 1-98 16 subtests skipped. Failed 6/179 test scripts. 154/8273 subtests failed. Files=179, Tests=8273, 103 wallclock secs (58.37 cusr + 6.43 csys = 64.80 CPU) Failed 6/179 test programs. 154/8273 subtests failed. make: *** [test_dynamic] Error 255 /usr/bin/make test -- NOT OK Running make install Writing /Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/.packlist Appending installation info to /System/Library/Perl/5.8.6/darwin-thread-multi-2level/perllocal.pod /usr/bin/make install -- OK Failed during this command: BIRNEY/bioperl-1.4.tar.gz : make_test FAILED but failure ignored because 'force' in effect