[Bioperl-l] remoteblast

Fields, Christopher J cjfields at illinois.edu
Tue May 27 15:04:45 UTC 2014 

This has also been made the default on the master and 1.6.x branches and will be in the next release.

chris

On May 14, 2014, at 12:23 PM, Jolyon Holdstock <Jolyon.Holdstock at ogt.com> wrote:

> Hi Scott,
> 
> That worked for me.
> 
> Thank you,
> 
> Jolyon
> 
> -----Original Message-----
> From: Scott Markel [mailto:Scott.Markel at accelrys.com] 
> Sent: 14 May 2014 17:18
> To: Jason Stajich; Jolyon Holdstock
> Cc: bioperl-l at lists.open-bio.org
> Subject: RE: [Bioperl-l] remoteblast
> 
> In this case the code change is straightforward and doesn't require any change to Bio::Tools::Run::RemoteBlast.  The constructor can take a URL_BASE argument, so just pass in the new URL (http://blast.ncbi.nlm.nih.gov/Blast.cgi).  This will overwrite the old URL (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi) hard-coded in Bio::Tools::Run::RemoteBlast.  We made this change to the remote BLAST components in the Pipeline Pilot Sequence Analysis collection and things have been fine.
> 
>    my @parameters = ("-prog"       => $program,
>                      "-data"       => $database,
>                      "-readmethod" => 'xml',
>                      "-URL_BASE"   => $url);
> 
>    my $blastFactory = Bio::Tools::Run::RemoteBlast->new(@parameters);
> 
> Hope this helps.
> 
> Scott
> 
> Scott Markel, Ph.D.
> Principal Bioinformatics Architect  email:  smarkel at accelrys.com Accelrys (Pipeline Pilot R&D)       mobile: +1 858 205 3653
> 5005 Wateridge Vista Drive          voice:  +1 858 799 5603
> San Diego, CA 92121                 fax:    +1 858 799 5222 USA                                 web:    http://www.accelrys.com
> 
> http://www.linkedin.com/in/smarkel
> Secretary, Board of Directors:
>     International Society for Computational Biology
> Chair: ISCB Publications and Communications Committee Associate Editor: PLOS Computational Biology Editorial Board: Briefings in Bioinformatics
> 
> Important change about my e-mail address: Following Accelrys's joining forces with Dassault Systèmes (3DS), my new e-mail address is scott.markel at 3ds.com.  Please add this new address to your Safe Senders list, to ensure you will continue to receive my e-mails.
> 
> 
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Jason Stajich
> Sent: Wednesday, 14 May 14 2014 7:49 AM
> To: Jolyon Holdstock
> Cc: bioperl-l at lists.open-bio.org
> Subject: Re: [Bioperl-l] remoteblast
> 
> So the BLAST services changed - not sure if we will still even support perl based - it will require a developer tracking and testing to the new NCBI resources since the have discontinued the older submission CGI resource.
> 
> You can run remote blast with commandline tool from NCBI as an alternative.
> 
> I think we will need to have a developer volunteer who wants to keep working on tracking the webservices for NCBI to keep this module working.
> 
> Jason
> 
> Jason Stajich
> jason.stajich at gmail.com
> 
> 
> On Thu, May 8, 2014 at 8:34 AM, Jolyon Holdstock
> <Jolyon.Holdstock at ogt.com>wrote:
> 
>> Hi,
>> 
>> I have a script that runs blast jobs against the databases at the NCBI.
>> 
>> I use the  Bio::Tools::Run::RemoteBlast module for the blasting.
>> 
>> It was working but is not now.
>> 
>> The following is an example of the response I now get:
>> 
>> --------------------- WARNING ---------------------
>> MSG: req was POST http://www.ncbi.nlm.nih.gov/blast/Blast.cgi
>> User-Agent: bioperl-Bio_Tools_Run_RemoteBlast/1.006901
>> Content-Length: 788
>> Content-Type: application/x-www-form-urlencoded
>> 
>> 
>> DATABASE=nr&QUERY=%3EHCV-54_contig_15+%0D%0ATCATAACAACCTTTTATGGTAAATAC
>> TAACAGCATGCCCATTTTACATGTGAGGAAACTGAGGCTTAGATCAGGTAAGTAGCTTATTCAGTGTTGC
>> TCAAGTAAATACGTTTTAAGAACCCTCAGCCTCGCTCTCCTCTTCCTCAGGGCACACTTTTTTTTTTTTC
>> CTTCCTACTGTGTGAGCTGTGGTGGGAATGTTAATCGGGATGCCTGTCTTTCCCTAGTCTTGGGGTCAGG
>> CAAGTGCTCAAAGTCAGGATAAGCAAACTCTCCTTCCTGGGACTCTGAGGAAAGGCTCATTGATGGGGGA
>> AATGGAGGGAGTGGATTCACTCCAGCTCAGCTCCGGGACAAGATGGCCATGGAGCTCCTGCTACATAAAT
>> GTCAGGGACTATCCTGGCTCCATCCTGCCTGCTTCCCTAGCTGCTGCCCAGCACTCACCTTATAAACATC
>> CTTCGAGCTGGAGTTAGCCCGAATTGGTTTCTGTCCCTTGTGACCACTGAGCCCTGGCTGACACAATCAC
>> AGGCTGGCGAGCAGAGGTACCAGAC&COMPOSITION_BASED_STATISTICS=off&EXPECT=1e-1
>> 0&SERVICE=plain&ALIGNMENTS=50&FORMAT_OBJECT=Alignment&CMD=Put&FILTER=L
>> &HITLIST_SIZE=5&DESCRIPTIONS=100&FORMAT_TYPE=Text&ALIGNMENT_VIEW=Pairw
>> ise&PROGRAM=blastn
>> 
>> <html>
>> <head><title>An Error Occurred</title></head> <body> <h1>An Error 
>> Occurred</h1>
>> <p>301 Moved Permanently</p>
>> </body>
>> </html>
>> 
>> ---------------------------------------------------
>> 
>> Can anyone suggest a fix?
>> 
>> Thanks,
>> 
>> Jolyon
>> 
>> 
>> Dr. Jolyon Holdstock,
>> Oxford Gene Technology
>> Begbroke Science Park
>> Begbroke Hill, Woodstock Road
>> Begbroke, Oxfordshire
>> OX5 1PF, UK
>> 
>> T: +44 (0)1865 856852
>> F: +44 (0)1865 848684
>> E: jolyon.holdstock at ogt.com<mailto:jolyon.holdstock at ogt.com>
>> W: www.ogt.com
>> 
>> [cid:image001.png at 01CB24EA.6FBDAD80]
>> 
>> Oxford Gene Technology - The Molecular Genetics Company(tm)
>> 
>> 
>>  *   CytoSure(tm) arrays<http://www.ogt.com/clinical_genetics> -
>> Class-leading products and services offering the complete array 
>> solution for clinical genetics research
>>  *   Cytocell(r) FISH probes<http://www.cytocell.com> - High-quality
>> products for the detection of gene rearrangements related to inherited 
>> genetic disease and cancer
>>  *   Genefficiency(tm) genomic services<
>> http://www.ogt.com/genomic_services>  - A tailored microarray and 
>> sequencing service enabling high-throughput, high-quality genomic 
>> studies for a variety of applications
>> 
>> Oxford Gene Technology (Operations) Ltd.  Registered in England No:
>> 03845432 Begbroke Science Park, Begbroke Hill, Woodstock Road, 
>> Begbroke, Oxfordshire, OX5 1PF, UK Confidentiality Notice: The 
>> contents of this email from the Oxford Gene Technology Group of 
>> Companies are confidential and intended solely for the person to whom 
>> it is addressed.  It may contain privileged and confidential 
>> information.  If you are not the intended recipient you must not read, 
>> copy, distribute, discuss or take any action in reliance on it. If you 
>> have received this email in error please advise the sender so that we 
>> can arrange for proper delivery.  Then please delete the message from 
>> your inbox.  Thank you.
>> CytoSure(tm) and Genefficiency(tm) NGS browser: For Research Use Only; 
>> Not for Use in Diagnostic Procedures< 
>> http://www.ogt.co.uk/terms_conditions/trademarks_and_disclaimers>
>> 
>> 
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

More information about the Bioperl-l mailing list