[Bioperl-l] remoteblast

Jolyon Holdstock Jolyon.Holdstock at ogt.com
Wed May 14 13:23:15 EDT 2014


Hi Scott,

That worked for me.

Thank you,

Jolyon

-----Original Message-----
From: Scott Markel [mailto:Scott.Markel at accelrys.com] 
Sent: 14 May 2014 17:18
To: Jason Stajich; Jolyon Holdstock
Cc: bioperl-l at lists.open-bio.org
Subject: RE: [Bioperl-l] remoteblast

In this case the code change is straightforward and doesn't require any change to Bio::Tools::Run::RemoteBlast.  The constructor can take a URL_BASE argument, so just pass in the new URL (http://blast.ncbi.nlm.nih.gov/Blast.cgi).  This will overwrite the old URL (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi) hard-coded in Bio::Tools::Run::RemoteBlast.  We made this change to the remote BLAST components in the Pipeline Pilot Sequence Analysis collection and things have been fine.

    my @parameters = ("-prog"       => $program,
                      "-data"       => $database,
                      "-readmethod" => 'xml',
                      "-URL_BASE"   => $url);
    
    my $blastFactory = Bio::Tools::Run::RemoteBlast->new(@parameters);

Hope this helps.

Scott

Scott Markel, Ph.D.
Principal Bioinformatics Architect  email:  smarkel at accelrys.com Accelrys (Pipeline Pilot R&D)       mobile: +1 858 205 3653
5005 Wateridge Vista Drive          voice:  +1 858 799 5603
San Diego, CA 92121                 fax:    +1 858 799 5222 USA                                 web:    http://www.accelrys.com

http://www.linkedin.com/in/smarkel
Secretary, Board of Directors:
    International Society for Computational Biology
Chair: ISCB Publications and Communications Committee Associate Editor: PLOS Computational Biology Editorial Board: Briefings in Bioinformatics

Important change about my e-mail address: Following Accelrys's joining forces with Dassault Systèmes (3DS), my new e-mail address is scott.markel at 3ds.com.  Please add this new address to your Safe Senders list, to ensure you will continue to receive my e-mails.


-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Jason Stajich
Sent: Wednesday, 14 May 14 2014 7:49 AM
To: Jolyon Holdstock
Cc: bioperl-l at lists.open-bio.org
Subject: Re: [Bioperl-l] remoteblast

So the BLAST services changed - not sure if we will still even support perl based - it will require a developer tracking and testing to the new NCBI resources since the have discontinued the older submission CGI resource.

You can run remote blast with commandline tool from NCBI as an alternative.

I think we will need to have a developer volunteer who wants to keep working on tracking the webservices for NCBI to keep this module working.

Jason

Jason Stajich
jason.stajich at gmail.com


On Thu, May 8, 2014 at 8:34 AM, Jolyon Holdstock
<Jolyon.Holdstock at ogt.com>wrote:

> Hi,
>
> I have a script that runs blast jobs against the databases at the NCBI.
>
> I use the  Bio::Tools::Run::RemoteBlast module for the blasting.
>
> It was working but is not now.
>
> The following is an example of the response I now get:
>
> --------------------- WARNING ---------------------
> MSG: req was POST http://www.ncbi.nlm.nih.gov/blast/Blast.cgi
> User-Agent: bioperl-Bio_Tools_Run_RemoteBlast/1.006901
> Content-Length: 788
> Content-Type: application/x-www-form-urlencoded
>
>
> DATABASE=nr&QUERY=%3EHCV-54_contig_15+%0D%0ATCATAACAACCTTTTATGGTAAATAC
> TAACAGCATGCCCATTTTACATGTGAGGAAACTGAGGCTTAGATCAGGTAAGTAGCTTATTCAGTGTTGC
> TCAAGTAAATACGTTTTAAGAACCCTCAGCCTCGCTCTCCTCTTCCTCAGGGCACACTTTTTTTTTTTTC
> CTTCCTACTGTGTGAGCTGTGGTGGGAATGTTAATCGGGATGCCTGTCTTTCCCTAGTCTTGGGGTCAGG
> CAAGTGCTCAAAGTCAGGATAAGCAAACTCTCCTTCCTGGGACTCTGAGGAAAGGCTCATTGATGGGGGA
> AATGGAGGGAGTGGATTCACTCCAGCTCAGCTCCGGGACAAGATGGCCATGGAGCTCCTGCTACATAAAT
> GTCAGGGACTATCCTGGCTCCATCCTGCCTGCTTCCCTAGCTGCTGCCCAGCACTCACCTTATAAACATC
> CTTCGAGCTGGAGTTAGCCCGAATTGGTTTCTGTCCCTTGTGACCACTGAGCCCTGGCTGACACAATCAC
> AGGCTGGCGAGCAGAGGTACCAGAC&COMPOSITION_BASED_STATISTICS=off&EXPECT=1e-1
> 0&SERVICE=plain&ALIGNMENTS=50&FORMAT_OBJECT=Alignment&CMD=Put&FILTER=L
> &HITLIST_SIZE=5&DESCRIPTIONS=100&FORMAT_TYPE=Text&ALIGNMENT_VIEW=Pairw
> ise&PROGRAM=blastn
>
> <html>
> <head><title>An Error Occurred</title></head> <body> <h1>An Error 
> Occurred</h1>
> <p>301 Moved Permanently</p>
> </body>
> </html>
>
> ---------------------------------------------------
>
> Can anyone suggest a fix?
>
> Thanks,
>
> Jolyon
>
>
> Dr. Jolyon Holdstock,
> Oxford Gene Technology
> Begbroke Science Park
> Begbroke Hill, Woodstock Road
> Begbroke, Oxfordshire
> OX5 1PF, UK
>
> T: +44 (0)1865 856852
> F: +44 (0)1865 848684
> E: jolyon.holdstock at ogt.com<mailto:jolyon.holdstock at ogt.com>
> W: www.ogt.com
>
> [cid:image001.png at 01CB24EA.6FBDAD80]
>
> Oxford Gene Technology - The Molecular Genetics Company(tm)
>
>
>   *   CytoSure(tm) arrays<http://www.ogt.com/clinical_genetics> -
> Class-leading products and services offering the complete array 
> solution for clinical genetics research
>   *   Cytocell(r) FISH probes<http://www.cytocell.com> - High-quality
> products for the detection of gene rearrangements related to inherited 
> genetic disease and cancer
>   *   Genefficiency(tm) genomic services<
> http://www.ogt.com/genomic_services>  - A tailored microarray and 
> sequencing service enabling high-throughput, high-quality genomic 
> studies for a variety of applications
>
> Oxford Gene Technology (Operations) Ltd.  Registered in England No:
> 03845432 Begbroke Science Park, Begbroke Hill, Woodstock Road, 
> Begbroke, Oxfordshire, OX5 1PF, UK Confidentiality Notice: The 
> contents of this email from the Oxford Gene Technology Group of 
> Companies are confidential and intended solely for the person to whom 
> it is addressed.  It may contain privileged and confidential 
> information.  If you are not the intended recipient you must not read, 
> copy, distribute, discuss or take any action in reliance on it. If you 
> have received this email in error please advise the sender so that we 
> can arrange for proper delivery.  Then please delete the message from 
> your inbox.  Thank you.
> CytoSure(tm) and Genefficiency(tm) NGS browser: For Research Use Only; 
> Not for Use in Diagnostic Procedures< 
> http://www.ogt.co.uk/terms_conditions/trademarks_and_disclaimers>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>

_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l





More information about the Bioperl-l mailing list