[Bioperl-l] (no subject)

[Hermann Norpois]

Hello,

I wrote a script to retrieve promoter sequences from genbank (see below)
that doesnt work in the get_stream modus. Input is an array (or list) of
geneids. In my output file (test4.fasta) only the last header is followed
by a sequence (see below). I guess I need a second stream but I do not know
how to construct.

Thank you very much for helping.

Hermann

*script:
*#!/bin/perl -w
use strict;
use warnings;
use Bio::DB::EntrezGene;
use Bio::SeqIO;
use Bio::DB::GenBank;


my $seqio_obj = Bio::SeqIO->new(-file => ">test4.fasta", -format => 'fasta'
); # outputfile

my $db = new Bio::DB::EntrezGene;

my $seqio = $db->get_Stream_by_id([54161, 12064, 71661]); # Gene ids

    while ( my $seq = $seqio->next_seq ) {

            my $ac = $seq->annotation;

            for my $ann ($ac->get_Annotations('dblink')) {
            if ($ann->database eq "Evidence Viewer") {
                # get the sequence identifier, the start, and the stop
        my ($contig,$from,$to) = $ann->url =~
          /contig=([^&]+).+from=(\d+)&to=(\d+)/;
                 my $chr_start = $from-700;
                 my $chr_stop = $from;
                 my $strand = 1;

                 my $gb  = Bio::DB::GenBank->new(-format     => 'fasta',
                                -seq_start  => $chr_start,
                                -seq_stop   => $chr_stop,
                               -strand     => $strand
                                );
               print "$contig\t$from\t$to\n\t$chr_start\t$chr_stop\n";  #
For control: Printing coordinates
                my $obj = $gb->get_Seq_by_id($contig);



                $seqio_obj->write_seq($obj);

    }
}
}

*test4.fasta*

>gi|28485536:10326633-10326632 Mus musculus chromosome 2 genomic contig,
strain C57BL/6J

>gi|28526280:23304000-23303999 Mus musculus chromosome 6 genomic contig,
strain C57BL/6J

>gi|372099010:6466323-6467023 Mus musculus strain C57BL/6J chromosome 7
genomic contig, GRCm38 C57BL/6J MMCHR7_CTG5_2
CCCCTCCCCGCAGCTTGATTCCTATAAAAACCTGCCATTTTGGATGAATGTGCTGTTCGC
CCTTGGCTCCTTTCTTGGTCCACTTGCCCTCTCTCTTCTCTCTCTCTCCTTTCACTTTCT...