[Bioperl-l] mummer3 output format

[Roy Chaudhuri]

Sorry, I'd completely missed Bio::AlignIO::mummer. However this seems to 
be aimed at parsing the output of the mummer program (as opposed to 
nucmer/promer) so I guess the advice about show-coords still stands.

On 01/03/2012 15:56, Roy Chaudhuri wrote:
> Hi Albert,
>
> The show-coords program converts the delta file into a coords file which
> is much easier to parse. It is run automatically if you provide the
> --coords flag to nucmer/promer.
>
> There was talk of a BioPerl MUMmer parser a while back but I'm not sure
> if it got anywhere.
>
> You might also look at Mugsy, which uses MUMmer and outputs MAF, so may
> contain some code that can be recycled - it is written in Perl I think.
>
> Cheers,
> Roy.
>
> On 01/03/2012 15:45, Albert Vilella wrote:
>> Hi,
>>
>> I am trying to understand how to transform Mummer3's output format
>> into something I can pipe into another program, like MAF or similar.
>> How can I parse the results so that I can then do a write_aln into MAF
>> o similar?
>>
>> Details:
>>
>> If I run nucmer v.3.23 with the options below, I get an out.delta like this:
>>
>> ~/MUMmer3.23/nucmer -maxgap $g -l $l $ref $qry
>>
>> ------------------
>> Leishmania_major.LM2.12.dna.toplevel.fa
>> LtarParrotTarIIGenomic_TriTrypDB-4.0.fasta
>> NUCMER
>>> LmjF.34 ULAVAL|LtaPseq521 1866748 641
>> 959335 959806 169 640 91 91 0
>> 20
>> 17
>> -3
>> -2
>> -183
>> 5
>> 0
>>> LmjF.12 ULAVAL|LtaPseq501 675346 1438
>> 322990 324081 1436 342 178 178 0
>> -45
>> -1
>> -1
>> -1
>>
>> This doesn't look like any of the formats in t/AlignIO/mummer.t to me.
>>
>> I can also run:
>>
>> ~/MUMmer3.23/show-aligns out.delta $region1 $region2
>>
>> Which gives me something that looks like a blast or exonerate output, like so:
>>
>> ------
>> Leishmania_major.LM2.12.dna.toplevel.fa
>> LtarParrotTarIIGenomic_TriTrypDB-4.0.fasta
>>
>> ============================================================
>> -- Alignments between LmjF.34 and ULAVAL|LtaPseq521
>>
>> -- BEGIN alignment [ +1 959335 - 959806 | +1 169 - 640 ]
>>
>>
>> 959335     cacacgcctcgtagaggtctccttgctttcgcgcggtgc.c.tcacttg
>> 169        cacacgcctcgtagagatc.ccctgccttcgcgcgg.gctcttcacttg
>>                              ^  ^  ^   ^         ^  ^ ^
>>
>> 959382     cgcatgcggtagtagaagagaatgctgtgggcccacccagcgtagttgc
>> 216        cgcatgcggtagtagaagagaatgctgtgtgcccacccagcgtagttgc
>>                                           ^
>>
>> 959431     caaacagcttccggaaggcctcctgaatgacgttatgatgccgctcgta
>> 265        caaacagtttccagaaggcatcctggataacattatgatgccgttcgta
>>                     ^    ^      ^     ^  ^  ^           ^
>>
>> 959480     caagggtgggacaggcgtttttcgtgaggcgcgcagcggggctgctgca
>> 314        caggggcggcacaggtgttttccgtaaggcacgtgaagaggtcgttgca
>>                ^   ^  ^     ^     ^   ^    ^  ^^^^ ^  ^^ ^
>>
>> 959529     gagcttccaccttcctctatcgccttta.cggtcgctggcgacacgcct
>> 363        gagcctccgtttcccttcaccgcccgcagcgat.gatgatgtcactcct
>>                  ^   ^^^ ^   ^^ ^    ^^^ ^  ^ ^ ^  ^^ ^   ^
>>
>> 959577     ttcttaaccttgagaacctccgcctgcttcctccactccagcagcagat
>> 411        ttcttcaccttgagagcctccgcctggttcttccactccaggagaagat
>>                   ^         ^          ^   ^          ^  ^
>>
>> 959626     tatcccgtgagcgggcttcctcttcgggcaacggacaccctggacgaga
>> 460        cagtgggtgcgcagacttcttcttcgcgcagtagagaccctgagcgaga
>>              ^ ^^^^   ^  ^ ^    ^      ^   ^^^  ^      ^^
>>
>> 959675     gcgcttacgacccaccgccgtcgcggcgcttggtgcggcaaggtactcc
>> 509        acgctttcgacccgccgatgtcacggtgcttgcggtggcaagatactcc
>>              ^     ^      ^   ^^   ^   ^     ^^ ^      ^
>>
>> 959724     accgcaacttgcgccatgtgcgtgtccacggggacaatgtgggtgcggt
>> 558        accgaaacctgcgccatgtgtgtgtccacggggacgatgtgggtgcggt
>>                  ^   ^           ^              ^
>>
>> 959773     tgagcgcgaagagcgccacgcagtcagcaacttt
>> 607        tgagagcaaagagcgccacgcaatccgccacttt
>>                  ^  ^              ^  ^  ^
>>
>>
>> --   END alignment [ +1 959335 - 959806 | +1 169 - 640 ]
>>
>> ============================================================
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>