[Bioperl-l] how to get the information of Strand = Plus / Plus from blastn report by bioperl.

Frank Schwach fs5 at sanger.ac.uk
Fri Jan 13 16:43:58 EST 2012


Hi Pawan,

Can you show your code? Is it basically following the structure shown in
http://www.bioperl.org/wiki/HOWTO:SearchIO#Using_SearchIO
?

If that is the case

$hsp->strand('query')


is exactly what you need.
To check if hit and query are on different strands you can do:

if ( $hsp->strand('query')
* $hsp->strand('hit') == -1){

   # do whatever you need to do if they are on opposite strands

}

Hope that helps

Frank




On 13/01/12 16:46, kakchingtabam pawankumar sharma wrote:
> Hi,
>               Using Bio::SearchIO module I am parsing the following Blast result.
> I have used the option- $hsp->strand('query').
>
> But I cannot get detail of alignment.
>
> I need to know if my hit is forward (Strand = Plus / Plus)
> or reverse ( Strand = Plus / Minus)...
>   Can anyone help me to get report as Plus or Minus for query  or hit.
>
> thanks in advanced.
>
> With regards,
> Pawan
>
>
>
> BLASTN 2.2.18 [Dec-23-2011]
>
>
> Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
> Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
> "Gapped BLAST and PSI-BLAST: a new generation of protein database search
> programs",  Nucleic Acids Res. 25:3389-3402.
>
> Query= 000013_c10079-9984
>           (50 letters)
>
> Database: Cyano_Probe.fasta
>             4760 sequences; 238,000 total letters
>
> Searching..................................................done
>
>
>
>                                                                   Score    E
> Sequences producing significant alignments:                      (bits) Value
>
> 000013_c10079-9984
> 100   7e-024
> 002619_2689273-2690037
> 24   0.36
> 001126_c1123720-1123385
> 24   0.36
> 003211_c3326737-3326480
> 22   1.4
> 002415_2471082-2471420
> 22   1.4
> 002269_2321276-2322463
> 22   1.4
> 001328_c1326535-1326164
> 22   1.4
>
>> 000013_c10079-9984
>            Length = 50
>
>   Score = 99.6 bits (50), Expect = 7e-024
>   Identities = 50/50 (100%)
>   Strand = Plus / Plus
>
>
> Query: 1  agtcaacaccaatctgagtttaatcactatcttgatcatgttagatatca 50
>            ||||||||||||||||||||||||||||||||||||||||||||||||||
> Sbjct: 1  agtcaacaccaatctgagtttaatcactatcttgatcatgttagatatca 50
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 



More information about the Bioperl-l mailing list