[Bioperl-l] blast result not matching.

[Manju Rawat]

Hi,
I doing blast using bioperl...but it not showing me complete result..


my program is following...

#!usr/bin/perl -w
use Bio::Perl;
# this script will only work with an internet connection
# on the computer it is run on
$seq = new_sequence("ATTGGTTTGGGGACCCAATTTGTGTGTTATATGTA");
$blast_result=blast_sequence($seq);
write_blast(">xyz.blast",$blast_result);


and Output..

BLASTN 2.2.25+


Stephen F. Altschul, Thomas L. Madden, Alejandro
A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and
David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new
generation of protein database search programs", Nucleic
Acids Res. 25:3389-3402.

Query= blast-sequence-temp-id
       (30 letters)

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST,
STS,GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
           14,527,398 sequences; 37,346,598,701 total letters

                                                                 Score
E
Sequences producing significant alignments:                      (bits)
value


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST,
STS,GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Sep 2, 2011  4:14 PM
    Number of letters in database: 37,346,598,701
    Number of sequences in database: 14,527,398

  Matrix: blastn matrix:2 -3
  Gap Penalties Existence: 5, Extension: 2
expect: 1e-10
allowgaps: yes
Search Statistics
A: 0
Hits_to_DB: 737,387
S1: 23
S1_bits: 22.0
S2: 77
S2_bits: 70.7
X1: 22
X1_bits: 20.1
X2: 33
X2_bits: 29.8
X3: 110
X3_bits: 99.2
dbentries: 14,527,398
dbletters: -1308106959
effectivedblength: 36,954,358,955
effectivespace: 110,863,076,865
effectivespaceused: 110,863,076,865
entropy: 0.912
entropy_gapped: 0.780
kappa: 0.408
kappa_gapped: 0.410
lambda: 0.634
lambda_gapped: 0.625
length_adjustment: 27
num_extensions: 8,057
num_successful_extensions: 8,057
number_of_hsps_better_than_expect_value_cutoff_without_gapping: 0
number_of_hsps_gapped: 8,057
number_of_hsps_successfully_gapped: 0
querylength: 3
seqs_better_than_1e-10: 0


this result is not matching with with NCBI result...
Is there anything wrong..


Thanks
Manju Rawat