[Bioperl-l] snp/frameshift identification

[Ross KK Leung]

Dear Bioperl-users,

Following Fields, Christopher J's advice on sequence extraction, I manage to
proceed to the last stage of non-synonymous SNP identification. Now what I
have in hand is thousands of reliable multiple sequence alignment files,
e.g.

>seq1
ATGACAGACACGACGTTGCCGTAG
>seq2
ATGACAGACACGACGTAGCCGTAG
>seq3
ATGACAGACACGACGTTGCCGTAG

Seq2 has a T->A mutation and that leads to a stop codon generation. I wonder
if Bioperl has handled this kind of SNP or frameshift or non-sense mutations
that lead to change of amino acid in the translated protein product.

Thanks again to the community that helps me a great deal so I can catch up
progress during this Sat/Sun!!