[Bioperl-l] Scripting help to identify adaptors count in reads

[Juan Jovel]

There are many ways to do it. 
Perhaps the simplest is to count the number of times the adapter sequence (or part of it) appears in each read. 
For example: 
$adapter_matches = tr/adapter_sequence/adapter_sequence/;# $adapter_matches will store the number of times the adapter sequence is repeated. 
You then place that result in a hash bin:
my %adapter_frequency;my $class = "$adapter_matches";if(exists $adapter_frequency{$class}){	$adapter_frequency{$class}++}else{	$adapter_frequency{$class} = 1}
# Then you can sort and output your classes
foreach $class (sort keys %adapter_frequency){                print "$class\t$adapter_frequency{$class}\n";        }

You can workout the details, but something like this should work.


 




> Date: Thu, 10 Nov 2011 04:29:55 -0800
> From: casaburi at ceinge.unina.it
> To: Bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l]  Scripting help to identify adaptors count in reads
> 
> 
> Hi everybody,
> 
> i have some reads (454) where there are adaptors (NNNN...), one,two or three
> adaptors for each reads depending on the reads. Is there any way to
> establish how many reads have 1 adaptors, how many 2 and how many 3 adaptors
> over the total ???
> 
> >271-88
> GCCTTGCCAGCCGCTCAGATTGATNNNNNNNNNNNNNNNATCAGGTGCCTACG
> >272-88
> GCCTTGCCAGCCGCTCAGATTGATNNNNNNNNNNNNNNNATCANNNNNNNNNNNNNNNCTGATGGCGCGAGGGAGGCGCCTTGCCAGCCCGCTCAGATTGATNNNNNNNNNNNNNNNCTGATGGCGCGAGGGAGGC
> >273-88
> GCCTCCCTCGCGCATCAGATCGTAGGCACCATCAATCTGAGCGGGCTGGCAAGGCGCCTCCCTCGCGCCA
> >274-88
> GCCTTGCCAGCCGCTCAGATTGATNNNNNNNNNNNNNNNCTGATGGCGCGAGGGAGGCGCCTCCCTCGCGCCATCAGATCGTNNNNNNNNNNNNNNNNNNTCGTAGGCACCATCAATCTGAGCGGGCTGGCAAGGCGCCTCCCTCGCGCCATCAGATCGTAGGCACCATCAA
> 
> The problem is that some adpators occur in the middle of the sequences
> because they coming out from a concameration experimental design (they are
> miRNAs between NNNNNN...). So i want to know a script or tool that may say
> how many reads have 1 adapt, how many 2, (max are 4) in respect to the total
> number of reads. Do you know any tool/script that may help ? Tnx 
> Can anyone suggests me a script to fix this ???
> 
> Thank you very much 
> -- 
> View this message in context: http://old.nabble.com/Scripting-help-to-identify-adaptors-count-in-reads-tp32818254p32818254.html
> Sent from the Perl - Bioperl-L mailing list archive at Nabble.com.
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l