[Bioperl-l] Bioperl 1.6.1 problem
Chris Fields
cjfields at illinois.edu
Wed Jul 13 23:05:12 EDT 2011
This works for me using the latest release on CPAN (1.6.901). I believe the error is a change in the URL which was fixed post-1.6.1.
chris
On Jul 13, 2011, at 5:58 AM, Galbáts Borisz wrote:
> Dear Sir or Madam!
>
> I'm new to Bioperl and got two probably very obvious problem (but I can't
> find the solution). I installed bioperl 1.6.1 to Win XP (ActivePerl 5.12).
> I hope I wrote to the appropriate e-mail address to discuss my problem.
>
> I copy my code here and the error message:
>
> #!/usr/bin/perl
>
> use warnings;
> use Bio::Perl;
>
> $seq = get_sequence('swissprot', 'P43780');
> write_sequence(">P43.fasta",'fasta',$seq);
>
>
> -------------------------(run the script)----------------------
>
> C:\Documents and Settings\Galbáts Borisz>perl biotest.perl
>
> ------------- EXCEPTION -------------
> MSG: WebDBSeqI Error - check query sequences!
>
> STACK Bio::DB::WebDBSeqI::get_seq_stream
> C:/Perl/site/lib/Bio/DB/WebDBSeqI.pm:50
> 8
> STACK Bio::DB::WebDBSeqI::get_Stream_by_acc
> C:/Perl/site/lib/Bio/DB/WebDBSeqI.pm
> :314
> STACK Bio::DB::WebDBSeqI::get_Seq_by_acc
> C:/Perl/site/lib/Bio/DB/WebDBSeqI.pm:18
> 6
> STACK Bio::Perl::get_sequence C:/Perl/site/lib/Bio/Perl.pm:520
> STACK toplevel biotest.perl:11
> -------------------------------------
>
> (if I use EMBL database, it works well)
>
>
>
>
>
> My second problem is the following (script):
>
> #!/usr/bin/perl
> use warnings;
> use Bio::Perl;
>
> $blast_result=blast_sequence(CTTCCCTTTACCTGTGCACCACTCCCTAATAAATTCATCTCCATTGGGAAA);
> write_blast(">bl.txt",$blast_result);
>
> -------------------------(run the script)----------------------
>
> ...........................ck to sign
> in"onclick="MyNCBI_auto_submit('http://www.ncbi.nlm.nih.gov/sites/myn
> cbi/?back_url=http%3A//blast.ncbi.nlm.nih.gov/Blast.cgi%3FALIGNMENTS%3D50%26ALIG
> NMENT%5FVIEW%3DPairwise%26CMD%3DPut%26COMPOSITION%5FBASED%5FSTATISTICS%3Doff%26D
> ATABASE%3Dnr%26DESCRIPTIONS%3D100%26ERROR%3DMessage%2BID%252324%2BError%253A%2BF
> ailed%2Bto%2Bread%2Bthe%2BBlast%2Bquery%253A%2BNucleotide%2BFASTA%2Bprovided%2Bf
> or%2Bprotein%2Bsequence%26EXPECT%3D1e%2D10%26FILTER%3DL%26FORMAT%5FOBJECT%3DAlig
> v/" title="National Library of
> Me............................................. (quite long part)
> dicine">NLM</a> | <a href="http://www.nih.gov/" title="National
> Institutes
> of Health">NIH</a> | <a href="http://www.hhs.gov/" title="US
> Department of
> Health and Human Services">DHHS</a> </p> <p> <a
> href='http://www.ncb
> i.nlm.nih.gov/About/disclaimer.html' title='NCBI intellectual
> property stat
> ement'>Copyright</a> | <a
> href='http://www.ncbi.nlm.nih.gov/About/disclaim
> er.html#disclaimer' title='About liability, endorsements, external
> links, p
> op-up advertisements'>Disclaimer</a> | <a
> href='http://www.nlm.nih.gov/pri
> vacy.html' title='NLM privacy policy'>Privacy</a> | <a
> href='http://w
> ww.ncbi.nlm.nih.gov/About/accessibility.html' title='About using NCBI
> resou
> rces with assistive technology'>Accessibility</a> | <a
> href='http://www.ncb
> i.nlm.nih.gov/About/glance/contact_info.html' title='How to get help,
> submi
> t data, or provide feedback'>Contact</a> | <a
> href='mailto:blast-help at ncbi.
> nlm.nih.gov' title='How to get help, submit data, or provide
> feedback'>Send
> feedback</a> </p></div> </div><!--/#wrap--><script
> type="text
> /javascript"
> src="http://www.ncbi.nlm.nih.gov/coreweb/javascript/nsuggest/nsugge
> st_loader.js"></script><script type="text/javascript"
> src="http://blast.ncbi.nlm
> .nih.gov/portal/portal3rc.fcgi/rlib/js/InstrumentOmnitureBaseJS/InstrumentNCBIBa
> seJS/InstrumentPageStarterJS.js"></script></body></html>
> ---------------------------------------------------
> Submitted Blast for [blast-sequence-temp-id]
>
>
>
> It seems it works but the output file (bl.txt) is always empty, whatever
> is the input sequence. The problem is I have no idea what should I expect
> when I run the script.
>
>
>
> Thank you for you help in advance.
>
> Your sincerely Borisz Galbáts (Hungary)
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
More information about the Bioperl-l
mailing list