[Bioperl-l] Reading and writing fastq files

[shalabh sharma]

Hi Ben,
        Thanks a lot, i didn't even noticed that, my bad.
I really appreciate it.

Thanks
Shalabh


On Sun, Feb 6, 2011 at 4:09 PM, Ben Bimber <bbimber at gmail.com> wrote:

> i think you want:
>
> $outr->write_seq($seq);
>
> instead of trying to write $in.
>
> -ben
>
>
>
> On Sun, Feb 6, 2011 at 2:42 PM, shalabh sharma
> <shalabh.sharma7 at gmail.com> wrote:
> > Hi,
> >    i am trying to read and write fastq files.
> > I can read them and can change format (like fastq files to fasta) but
> when i
> > try to write them back as 'fastq' format i am getting a warning:
> >
> > --------------------- WARNING ---------------------
> > MSG: You can't write FASTQ without supplying a Bio::Seq::Quality object!
> >
> > and i am not getting getting any output.
> > I am using bioperl 1.61
> >
> > My part of code looks like this:
> >
> > #!/usr/bin/perl -w
> > use Bio::SeqIO;
> > $in = Bio::SeqIO->new(-file => "$ARGV[0]", -format => 'fastq');
> > - - - - -- -
> >  - - - -- - -
> >
> > while(my $seq = $in->next_seq){
> >         -- - - - -  -
> >         - - - - - - -
> >         $outr->write_seq($in);
> > }
> >
> > fastq file looks like this:
> >
> > @1477:2:1:1143:901/1
> >
> NTCGGTACAGCGACAAACAGACGATATCACCGGCTAAGCTCGATGGTGGTTACGGATGCGAAACAACGTGGTAGCTCAGGTAAGGATTTAAGGCCTTCTATTACTTTGGTTAATGAAGGCCGTGAACCAATTTGTGTGCCTGGACTCAATA
> > +
> >
> BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
> > @1477:2:1:1143:901/2
> >
> ATTAACCACCGCACCTGCAGGCATTACATAATGCACCGCGATATTGGTTCCAGCCACCCAAATTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNGCTTCCCATCGNTAACCACCATC
> > +
> >
> \cf_ff[fdcfebcad^e\YadcYdceWe\^deaed_Y[c\dd[ce^bfbdbRLWa]R^BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
> > @1477:2:1:1166:923/1
> >
> NTACTCCAGCGGAAAATGCTACGCTTCGATCATTGCTAATATCAAATAACGTTTTTTGCTCAACCGATGAGCTTTCCAGTCGGTAAGGAAGCGGTTCATTAGCCTGAGCGAGCGGGTCAAAAACGATATCTTCGCGAGCTTCATACTTAAC
> > +
> >
> BKOHONNNMN_______________BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
> >
> > I would really appreciate if some one can help me out.
> >
> > Thanks
> > Shalabh
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
>