[Bioperl-l] SeqIO: paired end reads

[Lee Katz]

Thank you.  I figured out through the Newbler manual that there is a linker
sequence to separate the paired end reads.  Then, the forum at
http://seqanswers.com/forums/showthread.php?t=12940 showed me that the
linker sequence is "GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC".

I think a useful addition to bioperl could be to have paired end reads.

This is outside of the domain of bioperl, but now I am left wondering how I
could specify the distance between reads in Newbler, if the linker sequence
is fixed.

On Wed, Aug 3, 2011 at 5:17 PM, Jason Stajich <jason.stajich at gmail.com>wrote:

> it depends on the assembler - For Illumina usually the paired ends end with
> /1 /2 and they have the same ID but are in two different files. Depends on
> if you are using interleaved paired reads or in two separate files.  some
> just expect the paired reads to be mated by virtue of being in same order in
> two files.  the ABYSS and Velvet manuals both explain what is expected so
> you will want to check on what are Newbler's assumptions on how the paired
> ends are encoded.
>
> There are simulator tools if that is what you are trying to do in the end?
> checkout wgsim which comes with samtools or try dnaa
>
>
> On Aug 3, 2011, at 1:01 PM, Lee Katz wrote:
>
> > Hi all!  I was wondering how to construct paired end reads from scratch.
>  I
> > know the locations of certain sequences across the genome with a high
> degree
> > of confidence and so I want to give them to my assembler as paired end
> > reads, along with my other sequence runs (454 and Illumina runs).  I plan
> to
> > use Newbler.
> >
> > My only problem is that I do not know the correct format in order to
> specify
> > distance and sequences for a paired end reads run, and so I hope that
> there
> > is a SeqIO solution.  At the least, I hope that one bioperl member can
> point
> > me to where the definition of the paired end reads file format is...?
> >
> > Thank you!
> >
> > --Lee
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>