[Bioperl-l] Alignment from blast report

Paolo Pavan paolo.pavan at gmail.com
Mon Mar 1 18:07:33 EST 2010


Dear all,
Sorry for pushing up my post but, please does anyone have an hint for me?
Maybe have I to send attached the report to the mailing list? I don't
know attachment policies of the list, if it is allowed and is needed I
can do that.

Thank you,
Paolo

2010/2/26 Paolo Pavan <paolo.pavan at gmail.com>:
> Sorry,
> Maybe I forgot to add this is the megablast -m 5 output.
>
> Thank you again,
> Paolo
>
> 2010/2/26 Paolo Pavan <paolo.pavan at gmail.com>:
>> Hi all,
>> I have just a brief question: I've got some megablast reports such the
>> one I've pasted below.
>> I'm aware of the existence of the Bio::Search::IO::megablast and the
>> Bio::Search::HSP::BlastHSP::get_aln but, is there a way to get the
>> entire alignment represented as a Bio::SimpleAlign object or
>> Bio::Align::AlignI implementing one?
>>
>> Thank you all,
>> Paolo
>>
>>
>> MEGABLAST 2.2.16 [Mar-25-2007]
>>
>>
>> Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000),
>> "A greedy algorithm for aligning DNA sequences",
>> J Comput Biol 2000; 7(1-2):203-14.
>>
>> Database: 00038-00053.fasta
>>            2 sequences; 2001 total letters
>>
>> Searching..................................................done
>>
>> Query= 00038-00053
>>          (802 letters)
>>
>>
>>
>>                                                                  Score    E
>> Sequences producing significant alignments:                      (bits) Value
>>
>> ______00038
>> 226   1e-62
>> ______00053
>> 115   3e-29
>>
>> 1_0         472
>> ccgacaataattcttgttggaatcttcggcagttttttgtacaggagccagtagttcaaa 531
>> ______00038 883
>> ccgacaataattcttgttggaatcttcggcagttttttgtacaggagccagtagttcaaa 942
>> ______00053      ------------------------------------------------------------
>>
>> 1_0         532
>> aagaaagcgatcaataaaa-taaaaatcacaaaaaaattaccaaaaacatatttataaat 590
>> ______00038 943
>> aagaaagcgatcaataaaaataaaaatcacaaaaaaattaccaaaaacatatttataaa- 1001
>> ______00053      ------------------------------------------------------------
>>
>> 1_0         591
>> attggcaaaaaaattgccaacaattcccaaacggaaaattcccaaaacaaagagagcgtc 650
>> ______00038 1000
>> ------------------------------------------------------------ 1001
>> ______00053      ------------------------------------------------------------
>>
>> 1_0         651
>> gataaccaatatcaaaatagtttttgaatttattttttgtgtttttttagtttttcttct 710
>> ______00038 1000
>> ------------------------------------------------------------ 1001
>> ______00053      ------------------------------------------------------------
>>
>> 1_0         711
>> acgtcgtgttgccatttatccagcattaagtctataaaaaaaaacggtcagataaaaatg 770
>> ______00038 1000
>> ------------------------------------------------------------ 1001
>> ______00053 1    -------------------------ttaagtctataaaaaaaa-cggtcagataaaaatg 34
>>
>> 1_0         771  ccttaagtatttactttaacttgtcttgatca 802
>> ______00038 1000 -------------------------------- 1001
>> ______00053 35   ccttaagtatt-actttaacttgtcttgatca 65
>>   Database: 00038-00053.fasta
>>     Posted date:  Feb 25, 2010  4:47 PM
>>   Number of letters in database: 2001
>>   Number of sequences in database:  2
>>
>> Lambda     K      H
>>     1.37    0.711     1.31
>>
>> Gapped
>> Lambda     K      H
>>     1.37    0.711     1.31
>>
>>
>> Matrix: blastn matrix:1 -3
>> Gap Penalties: Existence: 0, Extension: 0
>> Number of Sequences: 2
>> Number of Hits to DB: 17
>> Number of extensions: 3
>> Number of successful extensions: 3
>> Number of sequences better than 10.0: 2
>> Number of HSP's gapped: 2
>> Number of HSP's successfully gapped: 2
>> Length of query: 802
>> Length of database: 2001
>> Length adjustment: 10
>> Effective length of query: 792
>> Effective length of database: 1981
>> Effective search space:  1568952
>> Effective search space used:  1568952
>> X1: 9 (17.8 bits)
>> X2: 20 (39.6 bits)
>> X3: 51 (101.1 bits)
>> S1: 9 (18.3 bits)
>> S2: 9 (18.3 bits)
>>
>




More information about the Bioperl-l mailing list