[Bioperl-l] questions

[Roy Chaudhuri]

Hi Jessica,

> Does any one knows how to add locations(CDS, Joins(600,140;...) to the new
> sequence object as feature,'

use Bio::SeqIO;
use Bio::Seq;
use Bio::Location::Split;
use Bio::Location::Simple;
use Bio::SeqFeature::Generic;
my $seq=Bio::Seq->new(-seq=>'ACTGATCGATGCATGATGTAGATCGATAGCTGCTA');
my $loc=Bio::Location::Split->new;
$loc->add_sub_Location(Bio::Location::Simple->new(-start=>4, -end=>6, 
-strand=>1);
$loc->add_sub_Location(Bio::Location::Simple->new(-start=>10, -end=>12, 
-strand=>1);
my $feat=Bio::SeqFeature::Generic->new(-primary_tag=>'misc_feat', 
-location=>$loc);
$seq->add_SeqFeature($feat);
my $out=Bio::SeqIO->new(-format=>'genbank';
$out->write_seq($seq);

> or if anyone knows how to keep the feature of truncated sequences object.

Look at the trunc_with_features method in Bio::SeqUtils:

use Bio::SeqUtils;
my $trunc=Bio::SeqUtils->trunc_with_features($seq, 2, 12);
$out->write_seq($trunc);


Hope this helps.
Roy.