[Bioperl-l] [Bug 2937] Strand in fasta35 output does not seem to be parsed

Tue Apr 20 08:03:54 UTC 2010

Hi Guys

Thanks for picking this up.  Let me know if I can help further.

Mick

From: Aaron Mackey [mailto:ajmackey at gmail.com]
Sent: 19 April 2010 14:49
To: michael watson (IAH-C)
Cc: Dave Messina; BioPerl List; William Pearson
Subject: Re: [Bioperl-l] [Bug 2937] Strand in fasta35 output does not seem to be parsed

OK, my apologies.  When I saw the multiple "autodoc" lines, I figured incorrectly.

-Aaron
On Mon, Apr 19, 2010 at 8:09 AM, michael watson (IAH-C) <michael.watson at bbsrc.ac.uk<mailto:michael.watson at bbsrc.ac.uk>> wrote:
Hi

I can guarantee this was from a single fasta execution, with input being a fasta file with multiple sequences. This output comes from the -O flag. There has been no concatenation.

Mick
________________________________________
From: Aaron Mackey [ajmackey at gmail.com<mailto:ajmackey at gmail.com>]
Sent: 19 April 2010 12:48
To: Dave Messina
Cc: michael watson (IAH-C); BioPerl List
Subject: Re: [Bioperl-l] [Bug 2937] Strand in fasta35 output does not seem to   be parsed

This doesn't looks like a multi-query report; rather this looks like multiple separate executions, each with one query, that has been concatenated together.  I don't think any of our report parsers will work in this scenario.

-Aaron

On Mon, Apr 19, 2010 at 7:35 AM, Dave Messina <David.Messina at sbc.su.se<mailto:David.Messina at sbc.su.se><mailto:David.Messina at sbc.su.se<mailto:David.Messina at sbc.su.se>>> wrote:
Hi Mick,

Please email the list - that way others who can help will know what's going on.

I looked at this for a few minutes and it seems that the issue is that the FASTA output doen't have any end-of-report indicator in a multiple query output file. The report just ends and then the next report begins.

e.g.

[ beginning of report 1 ]

 /usr/local/fasta3/bin/fasta35 -n -U -Q -H -A -E 2.0 -C 19 -m 0 -m 9i test.fa ../other_mirs.fa -O test.fasta35
FASTA searches a protein or DNA sequence data bank version 35.04 Mar. 26, 2009
Please cite:
 W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448

[ middle of report 1 omitted ]

                               10        20
2-210532                 UAGCUUAUCAGACUGAUGUUGAC
                       : :.:::::::. :::::
cel-miR-59          UCGAAUCGUUUAUCAGGAUGAUG
                          10        20

[ implicit end of report 1 ]

 /usr/local/fasta3/bin/fasta35 -n -U -Q -H -A -E 2.0 -C 19 -m 0 -m 9i test.fa ../other_mirs.fa -O test.fasta35
FASTA searches a protein or DNA sequence data bank version 35.04 Mar. 26, 2009
Please cite:
 W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448
[ rest of report 2 omitted [

I don't know whether or how this has changed from earlier versions of FASTA - presumably we were detecting end-of-report just fine for earlier versions - but in any case we need to fix it for version 35.

I will try to work on it some more but I'm pretty short of time right now - perhaps other devs could take a look?

Dave

On Apr 19, 2010, at 11:31, michael watson (IAH-C) wrote:

> Hi Dave
>
> I'm still having an associated bug from this fix, created last week:
>
> http://bugzilla.open-bio.org/show_bug.cgi?id=3058
>
> At present, this is a real show stopper for my analysis.
>
> Mick
>
> -----Original Message-----
> From: Dave Messina [mailto:David.Messina at sbc.su.se<mailto:David.Messina at sbc.su.se><mailto:David.Messina at sbc.su.se<mailto:David.Messina at sbc.su.se>>]
> Sent: 23 November 2009 17:46
> To: michael watson (IAH-C)
> Subject: Re: [Bug 2937] Strand in fasta35 output does not seem to be parsed
>
> Hi Mick,
>
> Sure thing -- the current build from subversion is packaged up every
> night and available here:
> http://www.bioperl.org/DIST/nightly_builds/
>
> Just grab bioperl-live.tar.gz from there and you'll get the changes.
>
>
> Dave
>
>
>
>
> On Nov 23, 2009, at 6:34 PM, michael watson (IAH-C) wrote:
>
>> Hi Dave
>>
>> Thanks for the hard work.
>>
>> Trying to get the latest updates so I can use this... don't have svn
>> on my server, tried to install it and I don't have python either,
>> which is needed to install it.
>>
>> I face about 3 weeks whilst my IT department sort this out, unless I
>> can access the changes any other way?
>>
>> Thanks
>> Mick
>>
>> -----Original Message-----
>> From: bugzilla-daemon at portal.open-bio.org<mailto:bugzilla-daemon at portal.open-bio.org><mailto:bugzilla-daemon at portal.open-bio.org<mailto:bugzilla-daemon at portal.open-bio.org>> [mailto:bugzilla-<mailto:bugzilla-><mailto:bugzilla-<mailto:bugzilla->>
>> daemon at portal.open-bio.org<mailto:daemon at portal.open-bio.org><mailto:daemon at portal.open-bio.org<mailto:daemon at portal.open-bio.org>>]
>> Sent: 20 November 2009 15:12
>> To: michael watson (IAH-C)
>> Subject: [Bug 2937] Strand in fasta35 output does not seem to be
>> parsed
>>
>> http://bugzilla.open-bio.org/show_bug.cgi?id=2937
>>
>>
>> online at davemessina.com<mailto:online at davemessina.com><mailto:online at davemessina.com<mailto:online at davemessina.com>> changed:
>>
>>          What    |Removed                     |Added
>> ----------------------------------------------------------------------------
>>            Status|NEW                         |RESOLVED
>>        Resolution|                            |FIXED
>>
>>
>>
>>
>> ------- Comment #7 from online at davemessina.com<mailto:online at davemessina.com><mailto:online at davemessina.com<mailto:online at davemessina.com>>  2009-11-20 10:12 EST
>> -------
>> Fixed in r16394.
>>
>> Michael, thanks for the report. Your test cases pass, but please
>> reopen the bug
>> if needed.
>>
>>
>> --
>> Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?
>> tab=email
>> ------- You are receiving this mail because: -------
>> You reported the bug, or are watching the reporter.
>

_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org<mailto:Bioperl-l at lists.open-bio.org><mailto:Bioperl-l at lists.open-bio.org<mailto:Bioperl-l at lists.open-bio.org>>
http://lists.open-bio.org/mailman/listinfo/bioperl-l