[Bioperl-l] Bio::Restriction::Analysis. Exception when using rebasefile.

[Mark A. Jensen]

Rasmus et al-

This looks like a bug. A quick debug shows it's barfing on 'AarI' (as it cycles 
through
all enzymes apparently creating a global cut map). AarI has a recognition 
sequence of

CACCTGC (in $enz->seq->seq)

but a cut site of

CACCTGCNNNN^ (in $enz->seq->site)

The bad parm '11' refers to the end of the cut site sequence, but the routine
B:R:Analysis::_cuts is attempting to split the 7-symbol recognition sequence,
and so throws.

This surprises me. Core, let me know if you want me to take this on, or
if the module author can fix it quicker.

cheers,
Mark

----- Original Message ----- 
From: "Rasmus Ory Nielsen" <ron at ron.dk>
To: <bioperl-l at lists.open-bio.org>
Sent: Wednesday, June 10, 2009 3:35 AM
Subject: [Bioperl-l] Bio::Restriction::Analysis. Exception when using 
rebasefile.


> Hi,
>
> This is my first time using bioperl for restriction analysis, so please bear 
> with me, if this is a FAQ.
>
> I downloaded withrefm.906 from ftp://ftp.neb.com/pub/rebase/ and created the 
> script shown at the bottom of the mail.
> My bioperl version is bioperl-live nightly from 09-Jun-2009.
>
> The scripts throws an exception - see below. But, if I comment out the 
> '-enzymes' argument, so it uses the built-in collection of enzymes, it works.
>
> My problem is, that I need to use some of the enzymes that are only available 
> in rebase. So how do I get this working?
>
> Thanks for your attention.
>
> Best regards,
> Rasmus Ory Nielsen
>
>
> ############################################################
> Output from the script:
> ############################################################
>
> [roni at ksdhcp ~]$ ./restriction_test.pl
>
> --------------------- WARNING ---------------------
> MSG: The enzyme name CviKI-1 was changed to CviKI-I
> ---------------------------------------------------
>
> ------------- EXCEPTION -------------
> MSG: Bad end parameter (11). End must be less than the total length of 
> sequence (total=7)
> STACK Bio::PrimarySeq::subseq 
> /usr/local/lib/perl5/site_perl/5.10.0/Bio/PrimarySeq.pm:401
> STACK Bio::Restriction::Analysis::_enzyme_sites 
> /usr/local/lib/perl5/site_perl/5.10.0/Bio/Restriction/Analysis.pm:900
> STACK Bio::Restriction::Analysis::_cuts 
> /usr/local/lib/perl5/site_perl/5.10.0/Bio/Restriction/Analysis.pm:801
> STACK Bio::Restriction::Analysis::cut 
> /usr/local/lib/perl5/site_perl/5.10.0/Bio/Restriction/Analysis.pm:379
> STACK Bio::Restriction::Analysis::fragment_maps 
> /usr/local/lib/perl5/site_perl/5.10.0/Bio/Restriction/Analysis.pm:515
> STACK toplevel ./restriction_test.pl:30
> -------------------------------------
>
> [roni at ksdhcp ~]$
>
>
> ############################################################
> Output from the script with the '-enzymes' argument commented out
> ############################################################
>
> [roni at ksdhcp ~]$ ./restriction_test.pl
>
> --------------------- WARNING ---------------------
> MSG: The enzyme name CviKI-1 was changed to CviKI-I
> ---------------------------------------------------
> $VAR1 = [
>           {
>             'seq' => 'CTCGACCGTTAGCAA',
>             'end' => 15,
>             'start' => '1'
>           },
>           {
>             'seq' => 'AGCTTTCTACCGTTATCGT',
>             'end' => 34,
>             'start' => '16'
>           }
>         ];
> [roni at ksdhcp ~]$
>
> ############################################################
>
> #!/usr/bin/perl
> use strict;
> use warnings;
> use Bio::PrimarySeq;
> use Bio::Restriction::IO;
> use Bio::Restriction::Analysis;
> use Data::Dumper;
>
> # create seq obj
> my $seqobj = new Bio::PrimarySeq(
>     -seq        => 'CTCGACCGTTAGCAAAGCTTTCTACCGTTATCGT',
>     -primary_id => 'test',
>     -molecule   => 'dna'
> );
>
> # read rebase file
> my $rebase_io = Bio::Restriction::IO->new(
>     -file   => 'withrefm.906',
>     -format => 'withrefm',
> );
> my $rebase_collection = $rebase_io->read;
>
> # start restriction analysis
> my $restriction_analysis = Bio::Restriction::Analysis->new(
>     -seq     => $seqobj,
>     -enzymes => $rebase_collection,    # it works with this line commented out
> );
>
> # retrieve fragment maps
> my @fragment_maps = $restriction_analysis->fragment_maps('HindIII');
> print Dumper \@fragment_maps;
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>