[Bioperl-l] Bio::Restriction::Analysis. Exception when using rebase file.

[Rasmus Ory Nielsen]

Hi,

This is my first time using bioperl for restriction analysis, so please bear 
with me, if this is a FAQ.

I downloaded withrefm.906 from ftp://ftp.neb.com/pub/rebase/ and created the 
script shown at the bottom of the mail.
My bioperl version is bioperl-live nightly from 09-Jun-2009.

The scripts throws an exception - see below. But, if I comment out the 
'-enzymes' argument, so it uses the built-in collection of enzymes, it works.

My problem is, that I need to use some of the enzymes that are only available 
in rebase. So how do I get this working?

Thanks for your attention.

Best regards,
Rasmus Ory Nielsen


############################################################
Output from the script:
############################################################

[roni at ksdhcp ~]$ ./restriction_test.pl

--------------------- WARNING ---------------------
MSG: The enzyme name CviKI-1 was changed to CviKI-I
---------------------------------------------------

------------- EXCEPTION -------------
MSG: Bad end parameter (11). End must be less than the total length of 
sequence (total=7)
STACK Bio::PrimarySeq::subseq 
/usr/local/lib/perl5/site_perl/5.10.0/Bio/PrimarySeq.pm:401
STACK Bio::Restriction::Analysis::_enzyme_sites 
/usr/local/lib/perl5/site_perl/5.10.0/Bio/Restriction/Analysis.pm:900
STACK Bio::Restriction::Analysis::_cuts 
/usr/local/lib/perl5/site_perl/5.10.0/Bio/Restriction/Analysis.pm:801
STACK Bio::Restriction::Analysis::cut 
/usr/local/lib/perl5/site_perl/5.10.0/Bio/Restriction/Analysis.pm:379
STACK Bio::Restriction::Analysis::fragment_maps 
/usr/local/lib/perl5/site_perl/5.10.0/Bio/Restriction/Analysis.pm:515
STACK toplevel ./restriction_test.pl:30
-------------------------------------

[roni at ksdhcp ~]$


############################################################
Output from the script with the '-enzymes' argument commented out
############################################################

[roni at ksdhcp ~]$ ./restriction_test.pl

--------------------- WARNING ---------------------
MSG: The enzyme name CviKI-1 was changed to CviKI-I
---------------------------------------------------
$VAR1 = [
           {
             'seq' => 'CTCGACCGTTAGCAA',
             'end' => 15,
             'start' => '1'
           },
           {
             'seq' => 'AGCTTTCTACCGTTATCGT',
             'end' => 34,
             'start' => '16'
           }
         ];
[roni at ksdhcp ~]$

############################################################

#!/usr/bin/perl
use strict;
use warnings;
use Bio::PrimarySeq;
use Bio::Restriction::IO;
use Bio::Restriction::Analysis;
use Data::Dumper;

# create seq obj
my $seqobj = new Bio::PrimarySeq(
     -seq        => 'CTCGACCGTTAGCAAAGCTTTCTACCGTTATCGT',
     -primary_id => 'test',
     -molecule   => 'dna'
);

# read rebase file
my $rebase_io = Bio::Restriction::IO->new(
     -file   => 'withrefm.906',
     -format => 'withrefm',
);
my $rebase_collection = $rebase_io->read;

# start restriction analysis
my $restriction_analysis = Bio::Restriction::Analysis->new(
     -seq     => $seqobj,
     -enzymes => $rebase_collection,    # it works with this line commented out
);

# retrieve fragment maps
my @fragment_maps = $restriction_analysis->fragment_maps('HindIII');
print Dumper \@fragment_maps;