[Bioperl-l] Packaging Bio::Ext::HMM for CPAN, was Re: Problems with Bioperl-ext package on WinVista?

Mon Aug 31 06:10:10 UTC 2009

Hi Chris

   I added a check for LocatableSeq in dpAlign.pm. It will now create an Bio::Seq object internally to copy the sequence in LocatableSeq but taking out all the gaps. This should make it behave properly. I commited the updated Bio/Tools/dpAlign.pm to SVN. In dpAlign.pm, I also added a note saying what will happen if you supplied LocatableSeq to the functions in this module.

   With regard to that warning, I think the person who reported the bug misused the instantiator of LocatableSeq. He/she can't use the length of the sequence with gaps as the "end". The "end" should be the length without gaps.

   Let me know if you have any questions or concerns.

Have a great day!
Yee Man

--- On Wed, 8/19/09, Yee Man Chan <ymc at yahoo.com> wrote:

> From: Yee Man Chan <ymc at yahoo.com>
> Subject: Re: [Bioperl-l] Packaging Bio::Ext::HMM for CPAN, was Re:  Problems with Bioperl-ext package on WinVista?
> To: "Chris Fields" <cjfields at illinois.edu>
> Cc: "Robert Buels" <rmb32 at cornell.edu>, "BioPerl List" <bioperl-l at lists.open-bio.org>
> Date: Wednesday, August 19, 2009, 8:01 PM
> I noticed that the $qalseq is a
> LocatableSeq with gaps. I don't think my program was written
> to support LocatableSeq with gaps. If I removed the gaps,
> then I would have the scores agree with each other which
> should be the desired outcome.
> 
> --------------------- WARNING ---------------------
> MSG: In sequence ABC|9986984 residue count gives end value
> 104.
> Overriding value [101] with value 104 for
> Bio::LocatableSeq::end().
> TTGCCATTCTTTCGAAGCGCATTCCCTCTCGTGGCGCTGGCTTCCAGGATCTTTTGGAAGCGCATTCGACGCAACACACCTGCCCGTTTCGGGTCCGGCCCGAA
> ---------------------------------------------------
> Getting score for ABC|9944760 -> ABC|9986984
> = 291
> Getting score for ABC|9986984 -> ABC|9944760
> = 291
> 
> Do you think I should check for this LocatableSeq type and
> give an error or should I remove the gaps if this is a
> LocatableSeq?
> 
> Yee Man
> 
> 
> --- On Wed, 8/19/09, Chris Fields <cjfields at illinois.edu>
> wrote:
> 
> > From: Chris Fields <cjfields at illinois.edu>
> > Subject: Re: [Bioperl-l] Packaging Bio::Ext::HMM for
> CPAN, was Re:  Problems with Bioperl-ext package on
> WinVista?
> > To: "Yee Man Chan" <ymc at yahoo.com>
> > Cc: "Robert Buels" <rmb32 at cornell.edu>,
> "BioPerl List" <bioperl-l at lists.open-bio.org>
> > Date: Wednesday, August 19, 2009, 7:49 AM
> > I'll have a look.  It's probably
> > something that hasn't been updated to deal with
> > LocatableSeq's pathological end point checking.
> > 
> > chris
> > 
> > On Aug 19, 2009, at 4:01 AM, Yee Man Chan wrote:
> > 
> > > 
> > > I tried that sample script that reportedly caused
> the
> > dpAlign "bug" but I can't reproduced it. All I get is
> a
> > warning from LocatableSeq.
> > > -------------------------------------------
> > > [ymc at dev Align]$ PERL_DL_NONLAZY=1 /usr/bin/perl
> > "-Iblib/lib" "-Iblib/arch"
> > "-I/home/ymc/bioperl/bioperl-live/trunk" test.pl
> > > 
> > > --------------------- WARNING
> ---------------------
> > > MSG: In sequence ABC|9944760 residue count gives
> end
> > value 101.
> > > Overriding value [104] with value 101 for
> > Bio::LocatableSeq::end().
> > >
> >
> TTGCCATTCTTTCGAAGCGCATTCCCTCTCGTGGCGCTGGCTTCCAGGATCTTTTGGAAGCGCATTCGACGCAACACACCTGCCCGTTT-GGG-CCGGCCC-AA
> > >
> ---------------------------------------------------
> > > Getting score for ABC|9944760 -> ABC|9986984
> > > = 300
> > > Getting score for ABC|9986984 -> ABC|9944760
> > > = 303
> > > ------------------------------------------
> > > 
> > > Does the test script crash in your machine?
> > > 
> > > Yee Man
> > > 
> > > --- On Tue, 8/18/09, Chris Fields <cjfields at illinois.edu>
> > wrote:
> > > 
> > >> From: Chris Fields <cjfields at illinois.edu>
> > >> Subject: Re: Packaging Bio::Ext::HMM for
> CPAN, was
> > Re: [Bioperl-l] Problems with Bioperl-ext package on
> > WinVista?
> > >> To: "Robert Buels" <rmb32 at cornell.edu>
> > >> Cc: "Yee Man Chan" <ymc at yahoo.com>,
> > "BioPerl List" <bioperl-l at lists.open-bio.org>
> > >> Date: Tuesday, August 18, 2009, 10:28 PM
> > >> On Aug 18, 2009, at 11:37 PM, Robert
> > >> Buels wrote:
> > >> 
> > >>> Yee Man Chan wrote:
> > >>>> Is it going to be an arrangement
> similar
> > to
> > >> bioconductor? If so, I suppose then it makes
> > sense. But you
> > >> might want to develop scripts to
> automatically
> > download and
> > >> install new modules to make it user
> friendly.
> > >>> Yes, we are probably going to make a
> > Task::BioPerl or
> > >> something similar.
> > >>> 
> > >>>> What do you mean by Bio-Ext is going
> away?
> > I
> > >> notice quite many people using dpAlign. So
> if
> > Bio-Ext is
> > >> going away, then at least dpAlign should
> become
> > another spin
> > >> off.
> > >>> By going away, I meant that everything
> in
> > there is
> > >> going to be spinned off.  Except modules
> that
> > are no
> > >> longer maintainable, if there are any in
> there.
> > >>> 
> > >>> Rob
> > >> 
> > >> dpAlign could become another spinoff, yes, if
> it's
> > used
> > >> (and works fine).  The problematic code
> dealt
> > with pSW,
> > >> alignment statistics, and staden io_lib
> support
> > (the latter
> > >> which is fairly bit rotted now):
> > >> 
> > >> http://bugzilla.open-bio.org/show_bug.cgi?id=2668
> > >> http://bugzilla.open-bio.org/show_bug.cgi?id=1857
> > >> http://bugzilla.open-bio.org/show_bug.cgi?id=2069
> > >> http://bugzilla.open-bio.org/show_bug.cgi?id=2074
> > >> http://bugzilla.open-bio.org/show_bug.cgi?id=2329
> > >> 
> > >> dpAlign has it's own bug:
> > >> 
> > >> http://bugzilla.open-bio.org/show_bug.cgi?id=2384
> > >> 
> > >> chris
> > >> 
> > > 
> > > 
> > > 
> > > 
> > > _______________________________________________
> > > Bioperl-l mailing list
> > > Bioperl-l at lists.open-bio.org
> > > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > 
> > 
> 
> 
> 
> 