[Bioperl-l] problem with Bio::Das::FeatureTypeI::name

Jason Stajich jason at bioperl.org
Sun Oct 26 19:08:15 EDT 2008


I'm a little confused why you have any SQL code in your program - that  
should all be handled under the hood by Bio::DB::GFF -- if you let it  
build your features for you it might work better.

At any rate, I can only guess this is because you aren't building the  
Feature object correctly or that the feature object you are passing in  
isn't respecting the API FeatureIO is using.

Can you get what you want just by doing a simple

Did you try calling the methods for getting segments (sequences) with  
features out via $gff_adaptor ?

-jason
On Oct 21, 2008, at 3:34 AM, Vincenza Maselli wrote:

> Dear All
>
> I tried to write a simple script to write a gff file, but my script  
> dead
> when try to execute the method  _write_feature_3 in the gff.pm  
> module but I
> got this message:
>
> Abstract method "Bio::Das::FeatureTypeI::name" is not implemented by  
> package
> Bio::DB::GFF::Typename.
> This is not your fault - author of Bio::DB::GFF::Typename should be
> blamed!
>
> Do you have any suggestion to overcome this problem? Did someone  
> implemented
> it?
>
> Thanks for the help
>
> Vincenza
>
>
> ================== START CODE
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> ======================================================================
> ! /usr/bin/perl
>
> use strict;
> use DBI;
> use DBD::mysql;
> use Data::Dumper;
> use Bio::FeatureIO;
> use Bio::DB::GFF;
> use Bio::DB::GFF::Featname;
> use Bio::SeqFeature::Generic;
>
> my $hostname = 'localhost';
> my $user = 'user';
> my $password = 'passwd';
> my $dsn = "dbi:mysql:database=dbname;host=$hostname";
>
>
> my $dbh = DBI->connect($dsn, $user, $password, 
> {PrintError=>0,RaiseError=>0})
> || die "Can't connect to database:$DBI::errstr\n";
>
> my $out = Bio::FeatureIO->new(-file    => ">>test.gff" ,
>                             -format  => 'GFF' ,
>                             -version => 3);
>
> # queries
>
> my $sql = qq{SELECT d.fid, d.fref, d.fstart, d.fstop, d.fbin,  
> d.fscore,
> d.fstrand, d.fphase,  d.ftarget_start, d.ftarget_stop,
>                    t.fmethod, t.fsource,
>            g.gid,g.gclass,g.gname
>         FROM fdata d, ftype t, fgroup g
>         WHERE d.ftypeid = t.ftypeid
>         AND d.gid = g.gid
>         LIMIT 1};
> my $sth = $dbh->prepare($sql);
> $sth->execute;
>
> # create GFF adaptor
>
> my $gff_adaptor = Bio::DB::GFF->new(-dsn => $dsn,
>            -user => $user,
>            -pass => $password);
>
> #initialize variables for feature object
>
> my $factory = $gff_adaptor;      #a Bio::DB::GFF adaptor object (or
> descendent)
>
> while (my $ref = $sth->fetchrow_hashref){
>  my $srcseq  = "ATGCGGATAGACGATAGCGATAACCTATAGTAGATCCGCTCGATCGTAGC";
> #the source sequence
>  my $start   = $ref->{'fstart'};     #start of this feature
>  my $stop    = $ref->{'fstop'};     #stop of this feature
>  my $method  = $ref->{'fmethod'};     #this feature's GFF method
>  my $source  = $ref->{'fsource'};     #this feature's GFF source
>  my $score   = $ref->{'fscore'};     #this feature's score
>  my $fstrand = $ref->{'fstrand'};     #this feature's strand  
> (relative to
> the source sequence, which has its own strandedness!)
>  my $phase   = $ref->{'fphase'};     #this feature's phase
>  my $group   = Bio::DB::GFF::Featname->new(-class => $ref- 
> >{'gclass'},-name
> => $ref->{'gname'});     #this feature's group
>  my $db_id   = $ref->{'fid'};     #this feature's internal database ID
>  my $group_id = $ref->{'gid'};
>  my $tstart = $ref->{'ftarget_start'};
>  my $tstop = $ref->{'ftarget_stop'};
> #create feature object
>
> my $feat = Bio::DB::GFF::Feature->new(
>                      $factory,
>                      $srcseq,
>                      $start,
>                      $stop,
>                      $method,
>                      $source,
>                      $score,
>                      $fstrand,
>                      $phase,
>                      $group,
>                      $db_id,
>                      $group_id,
>                      $tstart,
>                      $tstop);
>
>  #write out features
>  my $seq_feat = Bio::SeqFeature::Generic->new( -gff3_string =>
> $feat->gff3_string );
>  my $annseq = Bio::SeqFeature::Annotated->new(-start => $start,
>                                               -end => $stop,
>                           -phase => $phase);
>  $annseq->add_SeqFeature($feat);
>  $out->write_feature($annseq);
> }
>
> =========================== START RETURN
> ============================================================
>
>> $ perl
> create_gff.pl
>
>
> ------------- EXCEPTION: Bio::Root::NotImplemented -------------
> MSG: Abstract method "Bio::Das::FeatureTypeI::name" is not  
> implemented by
> package Bio::DB::GFF::Typename.
> This is not your fault - author of Bio::DB::GFF::Typename should be
> blamed!
>
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/local/lib/perl5/site_perl/5.10.0/Bio/Root/Root.pm:357
> STACK: Bio::Root::RootI::throw_not_implemented
> /usr/local/lib/perl5/site_perl/5.10.0/Bio/Root/RootI.pm:680
> STACK: Bio::Das::FeatureTypeI::name
> /usr/local/lib/perl5/site_perl/5.10.0/Bio/Das/FeatureTypeI.pm:142
> STACK: Bio::FeatureIO::gff::_write_feature_3
> /usr/local/lib/perl5/site_perl/5.10.0/Bio/FeatureIO/gff.pm:884
> STACK: Bio::FeatureIO::gff::_write_feature_3
> /usr/local/lib/perl5/site_perl/5.10.0/Bio/FeatureIO/gff.pm:934
> STACK: Bio::FeatureIO::gff::write_feature
> /usr/local/lib/perl5/site_perl/5.10.0/Bio/FeatureIO/gff.pm:263
> STACK: create_gff.pl:86
> ----------------------------------------------------------------
>
>
>
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> = 
> ======================================================================
>
> -- 
> Vincenza Maselli
> Dept. of Soil, Plant, Environmental and Animal Production Sciences
> University of Naples "Federico II"
> Via Universita' 100
> Parco Gussone - building number 75 "GenoPom"
> 80055 Portici, Naples, Italy
> phone: +39-081-2539246
> web: http://cab.unina.it
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org






More information about the Bioperl-l mailing list