[Bioperl-l] quick pairwise alignment

[Dave Messina]

Hi Alper,
Great -- glad I was able to help.

is it possible to see the "original" sequence that is used for BLAST in the
> alignment?


Sorry, I can't remember what ClustalW's output looks like. Would you like to
see something like this?

AGCGTGAGTAGTAGATGAGTAGTAGTGAGATGTGAGTAGTAAAAAGTGATGATGATGAGTAAAAAAAAA
|||||||||
AGCGTGAGT

If I were to do it, I think, since you get the start and stop positions of
the hit,  I might try to place the hit string in relation to the query
string. So in the code from before, instead of printing
$hsp_obj->query_string, you could print $input1->seq.

Or, I think if you run blastall outside of BioPerl, there are options for
query-anchored output, but you'd have to parse that out of the blast report
yourself.

But those are just off the top of my head. Anyone else reading, please chime
in if you've got better ideas.

Dave