[Bioperl-l]  problems with clustalw
    nisa_dar 
    vdar at yorku.ca
       
    Sat May 10 01:10:23 UTC 2008
    
    
  
Hi,
I need to do multiple sequence alignments of DNA sequences by using Bioperl.
I am using the following module
Bio::Tools::Run::Alignment::Clustalw;
and I am getting the following error message
Can't locate Bio/Tools/Run/Alignment/Clustalw.pm in @INC (@INC contains:
/share/iNquiry/perl/lib/5.8.5/x86_64-linux-thread-multi
/share/iNquiry/perl/lib/5.8.5
/share/iNquiry/perl/lib/x86_64-linux-thread-multi
/share/iNquiry/perl/lib/5.8.4 /share/iNquiry/perl/lib/5.8.3
/share/iNquiry/perl/lib/5.8.2 /share/iNquiry/perl/lib/5.8.1
/share/iNquiry/perl/lib/5.8.0 /share/iNquiry/perl/lib
/usr/lib64/perl5/5.8.5/x86_64-linux-thread-multi /usr/lib/perl5/5.8.5
/usr/lib64/perl5/site_perl/5.8.5/x86_64-linux-thread-multi
/usr/lib64/perl5/site_perl/5.8.4/x86_64-linux-thread-multi
/usr/lib64/perl5/site_perl/5.8.3/x86_64-linux-thread-multi
/usr/lib64/perl5/site_perl/5.8.2/x86_64-linux-thread-multi
/usr/lib64/perl5/site_perl/5.8.1/x86_64-linux-thread-multi
/usr/lib64/perl5/site_perl/5.8.0/x86_64-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.5 /usr/lib/perl5/site_perl/5.8.4
/usr/lib/perl5/site_perl/5.8.3 /usr/lib/perl5/site_perl/5.8.2
/usr/lib/perl5/site_perl/5.8.1 /usr/lib/perl5/site_perl/5.8.0
/usr/lib/perl5/site_perl
/usr/lib64/perl5/vendor_perl/5.8.5/x86_64-linux-thread-multi
/usr/lib64/perl5/vendor_perl/5.8.4/x86_64-linux-thread-multi
/usr/lib64/perl5/vendor_perl/5.8.3/x86_64-linux-thread-multi
/usr/lib64/perl5/vendor_perl/5.8.2/x86_64-linux-thread-multi
/usr/lib64/perl5/vendor_perl/5.8.1/x86_64-linux-thread-multi
/usr/lib64/perl5/vendor_perl/5.8.0/x86_64-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.5 /usr/lib/perl5/vendor_perl/5.8.4
/usr/lib/perl5/vendor_perl/5.8.3 /usr/lib/perl5/vendor_perl/5.8.2
/usr/lib/perl5/vendor_perl/5.8.1 /usr/lib/perl5/vendor_perl/5.8.0
/usr/lib/perl5/vendor_perl .) at mult_align.pl line 9.
BEGIN failed--compilation aborted at mult_align.pl line 9.
Here is the piece of code that gives this message
#!/usr/bin/perl -w
use Bio::SeqIO;
use Bio::Align::AlignI;
use Bio::AlignIO;
use Bio::AlignIO::msf;
use Bio::SimpleAlign;
use Bio::PrimarySeq;
use Bio::Tools::Run::Alignment::Clustalw;
use Bio::Root::IO;
use Bio::Seq;
my $query_string =
"tatgtggctggcgagacacgacacttcatatggttttacctctacgtttgagtaattaagtacaatgagctatcact";
my $hit_string =
"tatgtggctggcgagacacgacacttcatatggttttacctctacgtttgagtaattaagtacaatgagctatcact";
my $hit_string_two =
"tatgtggctggcgagacacgacacttcatatggttttacctctacgtttgagtaattaagtacaatgagctatcact";
my @params = ('ktuple' => 2, 'matrix' => 'BLOSUM');
my $factory = Bio::Tools::Run::Alignment::Clustalw->new(@params);
my $ktuple = 2;
$factory->ktuple($ktuple);
my $seq_obj_on = Bio::Seq->new(-id =>"thal", -seq =>"$query_string");
my $seq_obj_too = Bio::Seq->new(-id =>"lyrata", -seq =>"$hit_string");
my $seq_obj_thre = Bio::Seq->new(-id =>"boechera", -seq
=>"$hit_string_two");
my @seq_array = qw/$seq_obj_on $seq_obj_too $seq_obj_thre/;
my $seq_array_ref = \@seq_array;
my $aln = $factory->align($seq_array_ref);
I would appreciate if anyone could help. I don't know how to supply the
environment variables at unix so if this is the solution please explain how
can I do that. Thanks! 
-- 
View this message in context: http://www.nabble.com/problems-with-clustalw-tp17158917p17158917.html
Sent from the Perl - Bioperl-L mailing list archive at Nabble.com.
    
    
More information about the Bioperl-l
mailing list