[Bioperl-l] Can't parse blast report written by Bio::SearchIO::Writer::TextResultWriter
Prachi Shah
prachi at stanford.edu
Fri May 9 13:43:41 EDT 2008
Thanks. I have put in a bugzilla request. Although, I do need
suggestions to solve my immediate problems. Any hints are greatly
appreciated.
Thanks,
Prachi
On Thu, May 8, 2008 at 5:03 PM, Chris Fields <cjfields at uiuc.edu> wrote:
> You can always post it as an enhancement request in bugzilla. I don't think
> it would be too hard to implement.
>
> chris
>
> On May 8, 2008, at 5:35 PM, Prachi Shah wrote:
>
>>> I suspect somehow you are not reconstituting the Hit or Result objects
>>> properly,
>>> but I didn't try and debug this myself.
>>
>> Its possible, but I haven't been to point out what is going wrong. But
>> then, the writer object is able to write the report without incident.
>> I am at a loss.
>>
>>> You can specify a sort order function to the Result object now to specify
>>> the Hit order,
>>> maybe we should add sort function to Hit object for retrieving the
>>> underlying HSPs in a
>>> programmable order. Seems like that would be a cleaner fix.
>>
>> That would be ideal! But, until that is available, I will have to
>> make-do with such a solution.
>>
>> Thanks,
>> Prachi
>>
>>
>>> On May 8, 2008, at 1:54 PM, Prachi Shah wrote:
>>>
>>>> Hi all,
>>>>
>>>> I am trying to order of HSPs within each BLAST Hit in the order of
>>>> ascending P-values. So, I parse my WU-BLAST report using Bio::SearchIO
>>>> and create new Result, Hit and HSP objects in the order and then write
>>>> out another BLAST report with the
>>>> Bio::SearchIO::Writer::TextResultWriter module. All this works fine.
>>>> But, when I try to parse this new blast report with
>>>> Bio::SearchIO::blast, I get the following error:
>>>>
>>>> ------------- EXCEPTION -------------
>>>> MSG: no data for midline Query: 0 1
>>>> STACK Bio::SearchIO::blast::next_result
>>>> /tools/perl/5.6.1/lib/site_perl/5.6.1/Bio/SearchIO/blast.pm:1151
>>>> STACK toplevel bin/testBlastParse.pl:12
>>>> --------------------------------------
>>>>
>>>> I have copied below sample sections of both blast reports and the
>>>> code. Any hints/ pointers/ suggestions are greatly appreciated.
>>>>
>>>> Thanks,
>>>> Prachi
>>>>
>>>>
>>>>
>>>> The old vs new blast reports look slightly different, esp. note the
>>>> HSP start and stop coordinates for the QUERY sequence.
>>>>
>>>> **Snippet of OLD blast report (generated by WU-BLAST):
>>>>
>>>> ----------------------------------------------------------------------------------------------------
>>>> Query= orf19.4890
>>>> (4931 letters)
>>>>
>>>> Database: Ca21_Chromosomes
>>>> 9 sequences; 14,324,492 total letters.
>>>> Searching....10....20....30....40....50....60....70....80....90....100%
>>>> done
>>>>
>>>> WARNING: hspmax=1000 was exceeded by 8 of the database sequences,
>>>> causing the
>>>> associated cutoff score, S2, to be transiently set as high as
>>>> 113.
>>>>
>>>>
>>>> Smallest
>>>> Sum
>>>> High
>>>> Probability
>>>> Sequences producing High-scoring Segment Pairs: Score P(N)
>>>> N
>>>>
>>>> Ca21chr1 Assembly 21, Ca21chr1 (3188577 nucleotides) 24655 0.
>>>> 1
>>>> Ca21chr5 Assembly 21, Ca21chr5 (1190941 nucleotides) 1682
>>>> 3.4e-68 3
>>>> Ca21chr6 Assembly 21, Ca21chr6 (1033553 nucleotides) 908
>>>> 3.0e-34 3
>>>> Ca21chr2 Assembly 21, Ca21chr2 (2232049 nucleotides) 859
>>>> 4.7e-30 1
>>>> Ca21chr7 Assembly 21, Ca21chr7 (949626 nucleotides) 492
>>>> 7.3e-24 3
>>>> Ca21chr4 Assembly 21, Ca21chr4 (1603475 nucleotides) 528
>>>> 9.8e-21 2
>>>> Ca21chrR Assembly 21, Ca21chrR (2286425 nucleotides) 520
>>>> 1.4e-19 5
>>>> Ca21chr3 Assembly 21, Ca21chr3 (1799426 nucleotides) 502
>>>> 1.7e-14 2
>>>> Ca19-mtDNA Assembly 19, Ca19-mtDNA (40420 nucleotides) 313
>>>> 2.9e-06 2
>>>>
>>>>
>>>>> Ca21chr1 Assembly 21, Ca21chr1 (3188577 nucleotides)
>>>>
>>>> Length = 3,188,577
>>>>
>>>> Plus Strand HSPs:
>>>>
>>>> Score = 506 (82.0 bits), Expect = 4.9e-14, P = 4.9e-14
>>>> Identities = 850/1549 (54%), Positives = 850/1549 (54%), Strand = Plus /
>>>> Plus
>>>>
>>>> Query: 3450
>>>> ATGCATATGGTAATGTTAA-AATCACTGATTTTGGA-TTTTGTGCTAAATTAAC-T-GAT 3505
>>>> | | ||| | | || |||| ||| ||||| ||| | ||||| || | || | | | |
>>>> Sbjct: 155924
>>>> AGGGATACGATTAT-TTAAGAATT-CTGATATTGAAATTTTG-GC-ATTTTCATATAGTT
>>>> 155979
>>>>
>>>> Query: 3506
>>>> CAAAGA--AATAAACGTGCC-ACAATGGTGGGGACACCATATTGG-ATGGCACCTGAAGT 3561
>>>> |||| | |||||| | | |||| || | ||| | | ||| | | | |
>>>> Sbjct: 155980
>>>> CAAACATTAATAAATATATTGAAAATGTTGATTTAATCAT-TAGTCATG---CTGGTACT
>>>> 156035
>>>>
>>>> Query: 3562
>>>> GGTTAAACAAAAGGAATATGATGAAAAAGTTGATGTTTGGTCATTGGGGATTATGACTAT 3621
>>>> || | || | | || || | | | |||| | |||| |||| ||
>>>> Sbjct: 156036
>>>> GGATCAATCATTG--AT-TGTTTACAT--TTGAA--TAAACCATTAATTGTTATTGTTAA
>>>> 156088
>>>>
>>>> Query: 3622
>>>> TGAAATGATTGAAGGAGAACCACCTTATTTGAA-T-GAAGAACCATTAAAAGCATTATAT 3679
>>>>
>>>> ----------------------------------------------------------------------------------------------------
>>>>
>>>> **Snippet of NEW blast report (generated using
>>>> Bio::SearchIO::Writer::TextResultWriter)
>>>>
>>>> ----------------------------------------------------------------------------------------------------
>>>> uery= orf19.4890
>>>> (4,931 letters)
>>>>
>>>> Database: Ca21_Chromosomes
>>>> 9 sequences; 14,324,492 total letters
>>>>
>>>> Score
>>>> E
>>>> Sequences producing significant alignments: (bits)
>>>> value
>>>> Ca21chr1 Assembly 21, Ca21chr1 (3188577 nucleotides)
>>>> 24655 0.
>>>> Ca21chr5 Assembly 21, Ca21chr5 (1190941 nucleotides)
>>>> 1682 3.4e-68
>>>> Ca21chr6 Assembly 21, Ca21chr6 (1033553 nucleotides)
>>>> 908 3.0e-34
>>>> Ca21chr2 Assembly 21, Ca21chr2 (2232049 nucleotides)
>>>> 859 4.7e-30
>>>> Ca21chr7 Assembly 21, Ca21chr7 (949626 nucleotides)
>>>> 492 7.3e-24
>>>> Ca21chr4 Assembly 21, Ca21chr4 (1603475 nucleotides)
>>>> 528 9.8e-21
>>>> Ca21chrR Assembly 21, Ca21chrR (2286425 nucleotides)
>>>> 520 1.4e-19
>>>> Ca21chr3 Assembly 21, Ca21chr3 (1799426 nucleotides)
>>>> 502 1.7e-14
>>>> Ca19-mtDNA Assembly 19, Ca19-mtDNA (40420 nucleotides)
>>>> 313 2.9e-06
>>>>
>>>>
>>>>> Ca21chr1 Assembly 21, Ca21chr1 (3188577 nucleotides)
>>>>
>>>> Length = 3188577
>>>>
>>>> Score = 3705.3 bits (24655), Expect = 0., P = 0.
>>>> Identities = 4931/4931 (100%)
>>>> Frame = -1 / +1
>>>>
>>>> Query: 1
>>>> ATAAAGGATGCCAAATAGTAGTAGTAAAATAGTAAATAGAATTGCAAAACAAAAATGATT -58
>>>> ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
>>>> Sbjct: 2248574
>>>> ATAAAGGATGCCAAATAGTAGTAGTAAAATAGTAAATAGAATTGCAAAACAAAAATGATT
>>>> 2248633
>>>>
>>>> Query: -59
>>>> AAATAGCCCTTTATCAATAAATTTTTAAAGTTAGTTTCTTCTGGAACCCTACCCTCTTGG -118
>>>> ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
>>>> Sbjct: 2248634
>>>> AAATAGCCCTTTATCAATAAATTTTTAAAGTTAGTTTCTTCTGGAACCCTACCCTCTTGG
>>>> 2248693
>>>>
>>>> Query: -119
>>>> TGTTAATCTTTTAAGTTAATATTTATAGTTAATAAAGTAGAAGTGTCTATTTATTGATTG -178
>>>> ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
>>>> Sbjct: 2248694
>>>> TGTTAATCTTTTAAGTTAATATTTATAGTTAATAAAGTAGAAGTGTCTATTTATTGATTG
>>>> 2248753
>>>>
>>>> Query: -179
>>>> TTGTTGTTGTTGATTAAGAATATAAAGAAAAACAGAAAAGAAAAAAAGAAGGTTTAAAAA -238
>>>> ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
>>>> Sbjct: 2248754
>>>> TTGTTGTTGTTGATTAAGAATATAAAGAAAAACAGAAAAGAAAAAAAGAAGGTTTAAAAA
>>>> 2248813
>>>>
>>>> Query: -239
>>>> AGTTAATTGTGAAGTAAAAGGGTTGAAAAATTTTTTTTTTTTCTGTTTCTCTCTTTGAGA -298
>>>> ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
>>>> Sbjct: 2248814
>>>> AGTTAATTGTGAAGTAAAAGGGTTGAAAAATTTTTTTTTTTTCTGTTTCTCTCTTTGAGA
>>>> 2248873
>>>>
>>>> Query: -299
>>>> TTCTTTGACATATTTATTATTATAACACTATGCTATACTAAAAACAGTACTACCAATTGA -358
>>>> ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
>>>> Sbjct: 2248874
>>>> TTCTTTGACATATTTATTATTATAACACTATGCTATACTAAAAACAGTACTACCAATTGA
>>>> 2248933
>>>>
>>>> Query: -359
>>>> ATTAAATTAAATTAAATTAAATTAAATTATTAGACCAATTTCAATAAAGATAAGCAATTT -418
>>>>
>>>>
>>>> ----------------------------------------------------------------------------------------------------
>>>>
>>>> **Here is the snippet of code that reads the old report, generates new
>>>> objects and writes new report:
>>>>
>>>> ----------------------------------------------------------------------------------------------------
>>>> my $blast_report = Bio::SearchIO->new(-format => 'blast',
>>>> -file => $blastOutputTmp);
>>>>
>>>> my $writer =
>>>> Bio::SearchIO::Writer::TextResultWriter->new(-no_wublastlinks => 0);
>>>> my $out_blast_report = Bio::SearchIO->new(-writer => $writer,
>>>> -file => ">$blastOutputFile");
>>>>
>>>> my $sorted_blast_report;
>>>>
>>>> while( my $result = $blast_report->next_result ) {
>>>>
>>>> my (%parameters, %statistics);
>>>>
>>>> foreach my $param ($result->available_parameters) {
>>>>
>>>> $parameters{$param} = $result->get_parameter($param);
>>>> }
>>>>
>>>> foreach my $stat ($result->available_statistics) {
>>>>
>>>> $statistics{$stat} = $result->get_statistic($stat);
>>>> }
>>>>
>>>> my $generic_result =
>>>> Bio::Search::Result::BlastResult->new(-query_name =>
>>>> $result->query_name,
>>>> -query_length =>
>>>> $result->query_length,
>>>> -database_name =>
>>>> $result->database_name,
>>>> -database_entries =>
>>>> $result->database_entries,
>>>> -parameters => \%parameters,
>>>> -statistics => \%statistics,
>>>> -algorithm =>
>>>> $result->algorithm,
>>>> -query_description =>
>>>> $result->query_description,
>>>> -algorithm_reference =>
>>>> $result->algorithm_reference,
>>>> -algorithm_version =>
>>>> $result->algorithm_version,
>>>> -database_letters =>
>>>> $result->database_letters);
>>>>
>>>> while( my $hit = $result->next_hit ) {
>>>>
>>>> my $generic_hit = Bio::Search::Hit::BlastHit->new(-name
>>>> => $hit->name,
>>>> -algorithm => $hit->algorithm,
>>>> -description => $hit->description,
>>>> -length => $hit->length,
>>>> -score => $hit->score,
>>>> -bits => $hit->bits,
>>>> -significance => $hit->significance);
>>>>
>>>> my (@hsp_sorted, @hsps);
>>>> while( my $hsp = $hit->next_hsp ) {
>>>>
>>>> push(@hsps, $hsp);
>>>> }
>>>>
>>>> @hsp_sorted = sort {$a->pvalue <=> $b->pvalue} @hsps;
>>>>
>>>> for(my $i=0; $i<=$#hsp_sorted; $i++) {
>>>>
>>>> $generic_hit->add_hsp($hsp_sorted[$i]);
>>>>
>>>> }
>>>>
>>>> $generic_result->add_hit($generic_hit);
>>>>
>>>> }
>>>>
>>>> $out_blast_report->write_result($generic_result);
>>>>
>>>> }
>>>>
>>>> ----------------------------------------------------------------------------------------------------
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>
>
More information about the Bioperl-l
mailing list