[Bioperl-l] Help for extracting CDS sequences from FASTA form
sheng zhao
harryzs1981 at yahoo.com.cn
Fri Sep 21 12:30:45 EDT 2007
Dear sir:
Thank you for your relp.
I got these sequences from NCBI(ftp.ncbi.nlm.nih.gov/repository/UniGene/Bos_taurus/Bt.seq.uniq.gz).
Would you mind to tell me how to get gb or gi ids from this form?
Thank you again.
Best wishes.
Harry
Sendu Bala <bix at sendu.me.uk> дµÀ£º
sheng zhao wrote:
> >gnl|UG|Bt#S37443275 [snip] /gb=BC133480 /gi=126717494 /ug=Bt.3 /len=572
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGC
[snip]
> I would like to know how to extract CDS sequences from them? Or a Perl program?
Where did you get the fasta sequences from? It would be easiest to go to
the source that originally generated them and get it to give you the CDS
coordinates as well.
Failing that you can get them from the NCBI database using the gb or gi ids.
Someone else will be along to give you the Bioperl code to do that, I'm
sure :)
---------------------------------
ÑÅ»¢ÓÊÏ䣬ÖÕÉú»ï°é£¡
More information about the Bioperl-l
mailing list