[Bioperl-l] Help for extracting CDS sequences from FASTA form

Sendu Bala bix at sendu.me.uk
Fri Sep 21 11:28:30 EDT 2007


sheng zhao wrote:
> >gnl|UG|Bt#S37443275 [snip] /gb=BC133480 /gi=126717494 /ug=Bt.3 /len=572
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGC
[snip]
> I would like to know how to extract CDS sequences from them? Or a Perl program?

Where did you get the fasta sequences from? It would be easiest to go to 
the source that originally generated them and get it to give you the CDS 
coordinates as well.

Failing that you can get them from the NCBI database using the gb or gi ids.

Someone else will be along to give you the Bioperl code to do that, I'm 
sure :)



More information about the Bioperl-l mailing list