[Bioperl-l] run RNAfold in perl

vanam arvindvanam at gmail.com
Sat Nov 24 02:29:11 EST 2007


i have seen the documentation for Bio::Tools::Run::AnalysisFactory::Pise and
i used it exactly as it was mentioned in it.

i just want that instead of running its perl version "RNAfold.pl" I can use
the functions associated with RNAfold with a perl program without having to
call the program using system() command.

if you can just tell me how to use these wrapper modules it would b of gr8
help...like while using clustalw or clustalx we define the environment
variable for it ..do we have to do the same for RNAfold or Mfold




Chris Fields wrote:
> 
> The Pise wrappers run the programs remotely; see  
> Bio::Tools::Run::AnalysisFactory::Pise on how to run it.  As for a  
> local RNAfold wrapper, I had planned on making Bioperl-based Vienna/ 
> mfold wrappers but haven't done so yet.  The Vienna tools do have a  
> Perl-based (non-BioPerl-based) module included which uses libRNA, and  
> is well worth a look.  Try 'perldoc RNA' if you have installed the  
> tools locally, or look here for other Perl-based tools:
> 
> http://www.tbi.univie.ac.at/~ivo/RNA/utils.html
> 
> chris
> 
> On Nov 23, 2007, at 3:26 PM, vanam wrote:
> 
>>
>> how to run RNAfold using Bio::Tools::Run::AnalysisFactory::Pise?????
>>
>> my $factory = Bio::Tools::Run::AnalysisFactory::Pise->new();
>> my $rnafold = $factory->program('rnafold');
>> my $job=$rnafold->run(-rnafold =>
>> 'UUUGACGACAGACGACUCAAUGUCAGCUAGCUAGUACGAUCGAUC');
>>
>> I installed Vienna package and then i tried using Pise to create an  
>> object
>> for the program but its giving the following error
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: Bio::Tools::Run::PiseJob terminated: URL missing
>> STACK: Error::throw
>> STACK: Bio::Root::Root::throw
>> /usr/local/share/perl/5.8.8/Bio/Root/Root.pm:359
>> STACK: Bio::Tools::Run::PiseJob::terminated
>> /usr/local/share/perl/5.8.8/Bio/Tools/Run/PiseJob.pm:460
>> STACK: Bio::Tools::Run::PiseApplication::submit
>> /usr/local/share/perl/5.8.8/Bio/Tools/Run/PiseApplication.pm:416
>> STACK: Bio::Tools::Run::PiseApplication::run
>> /usr/local/share/perl/5.8.8/Bio/Tools/Run/PiseApplication.pm:352
>> STACK: evaluate.pl:12
>>
>>
>> how to make the program RNAfold run in perl...
>> IS THERE ANY NEED TO SPECIFY WHERE MY rnafold program is???
>>
>> plz reply soon
>> -- 
>> View this message in context: http://www.nabble.com/run-RNAfold-in- 
>> perl-tf4863835.html#a13918981
>> Sent from the Perl - Bioperl-L mailing list archive at Nabble.com.
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
> 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> 

-- 
View this message in context: http://www.nabble.com/run-RNAfold-in-perl-tf4863835.html#a13922740
Sent from the Perl - Bioperl-L mailing list archive at Nabble.com.




More information about the Bioperl-l mailing list