[Bioperl-l] a problem with standalone blast

Thiago Venancio thiago.venancio at gmail.com
Mon Mar 12 06:44:47 EDT 2007


Hi Zhihua,

I have this problem once. It is most probably caused by a conbination of
small subject sequences with low complexity regions.
This seems to be your case...

T.

On 3/11/07, zhihua li <lzhtom at hotmail.com> wrote:
>
> HI all,
>
> I know this is probably not a right question to ask here, 'cause it's
> solely blast, although i did try using standalone blastall module.  But I
> couldn't find any other suitable mailing lists. So i hope guys here could
> help me out.
>
> Recently I got a problem when I tried to blast a nucleotide sequence
> against a database. The problem occured when I was using blast module in
> perl, but then i realized it was caused by blast directly.
>
> The database was generated with formatdb and is correct, 'cause all other
> queries went through quite well.
>
> The problematic query sequence is:
> >ENSG00000162825.7
> GGGGAAGAAGATCAAAGAAGAAAGAAGAAGGGGAAGAAAAGAAGGGGAAGAAG
>
> The only difference it has compared with other successful queries is that
> it's shorter .
>
> After running blastn I got the following message:
> [blastall] WARNING: ENSG00000162825.7: Could not calculate ungapped
> Karlin-Altschul parameters due to an invalid query sequence or its
> translation. Please verify the query sequence(s) and/or filtering options.
>
> At first I thought it might have been masked out too much during the
> filtering process. So I ran it again with the filtering switched off.
> After that I got following error:
> [blastall] ERROR: Threshold for extending hits, default if zero
>       blastp 11, blastn 0, blastx 12, tblastn 13
>       tblastx 13, megablast 0 [F] is bad or out of range [? to ?]
>
> Could you help me out with this?
>
> Thanks a lot!
>
>
>                          Zhihua Li
>
> _________________________________________________________________
> ÓëÁª»úµÄÅóÓѽøÐн»Á÷£¬ÇëʹÓà MSN Messenger:  http://messenger.msn.com/cn
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
"The way to get started is to quit talking and begin doing."
      Walt Disney

========================
Thiago Motta Venancio, MSc
PhD student in Bioinformatics
University of Sao Paulo
========================




More information about the Bioperl-l mailing list