[Bioperl-l] seq doesn't validate error

Sheri Simmons sheris at eps.berkeley.edu
Fri Jun 15 19:53:04 EDT 2007


Thanks for the suggestion, but that still gives the same error as before.

On Friday 15 June 2007 4:11 pm, Kevin Brown wrote:
> > I'm getting an error as follows when I try to reverse
> > complement a sequence string stored in a hash of arrays. The
> > storage code is:
> >
> > 		$nstarthash{$key} = [$sortchecks[0], join("",
> > @nseq),
> > join("",@{$seqhash{$key}})];
> >
> > the sequence of interest is the element at index 1.
> >
> > Later, I try to retrieve this string for a subset of keys so
> > I can reverse complement it based on input from another hash
> > (%complement):
> >
> > 			my %revcomphash = map { my $read = $_;
> > 			grep $complement{$read} eq 'C', %complement;
> > 			{$_, (Bio::Seq->new(-seq
> > =>$nstarthash{$_}[1]))->revcom->seq()};}
> > 			 keys(%nstarthash);
> >
> >
> > I get the following warning (long sequence edited for clarity):
> >
> > -- -------------------- WARNING ---------------------
> > MSG: seq doesn't validate, mismatch is 1
> > ---------------------------------------------------
> >
> > ------------- EXCEPTION  -------------
> > MSG: Attempting to set the sequence to
> > [GCCCCTGTAATCGCTTTTATATCGTCAGCGATC]
> > which does not look healthy
> > STACK Bio::PrimarySeq::seq /usr/share/perl5/Bio/PrimarySeq.pm:268
> > STACK Bio::PrimarySeq::new /usr/share/perl5/Bio/PrimarySeq.pm:217
> > STACK Bio::Seq::new /usr/share/perl5/Bio/Seq.pm:498 STACK
> > toplevel ../quality_wrapper.pl:103
> >
> > I cannot find any non-allowed characters in the sequence, and
> > the de-referencing appears to work correctly. Can anyone help me?
> > I'm using the latest Bioperl installation (1.5.2) with
> > ActivePerl5.8 on a Mepis 6.5 system.
>
> Try telling the Bio::Seq object what alphabet to use when creating it.
> I tend to create them like:
>
> Bio::Seq->new(-seq=> $seqvar, -alphabet=>'dna')

-- 
Sheri Simmons
Department of Earth and Planetary Sciences
University of California, Berkeley
Berkeley, CA 94720-4767



More information about the Bioperl-l mailing list