[Bioperl-l] Output a subset of FASTA data from a single large file

Cook, Malcolm MEC at stowers-institute.org
Fri Jun 9 10:58:22 EDT 2006


I wouldn't bioperl for this, or create an index.  Perl would do fine and
probably be faster.

Assuming your ids are one per line in a file named id.dat looking like
this

1138_at
1134_at
etc..

this should work: 

perl -n -e 'BEGIN{open(idfile, shift) or die "no can open"; @ID =
<idfile>; chomp @ID; %ID = map {($_, 1)} @ID;}  $inmatch =
exists($ID{$1}) if /^>probe:\w+:(\w+):/; print if $inmatch' id.dat
mybigfile.fa

good luck

--Malcolm Cook 

>-----Original Message-----
>From: bioperl-l-bounces at lists.open-bio.org 
>[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of 
>Michael Oldham
>Sent: Thursday, June 08, 2006 9:08 PM
>To: bioperl-l at lists.open-bio.org
>Subject: [Bioperl-l] Output a subset of FASTA data from a 
>single large file
>
>Dear all,
>
>I am a total Bioperl newbie struggling to accomplish a 
>conceptually simple
>task.  I have a single large fasta file containing about 200,000 probe
>sequences (from an Affymetrix microarray), each of which looks 
>like this:
>
>>probe:HG_U95Av2:1138_at:395:301; Interrogation_Position=2631; 
>Antisense;
>TGGCTCCTGCTGAGGTCCCCTTTCC
>
>What I would like to do is extract from this file a subset of ~130,800
>probes (both the header and the sequence) and output this 
>subset into a new
>fasta file.  These 130,800 probes correspond to 8,175 probe set IDs
>("1138_at" is the probe set ID in the header listed above); I 
>have these
>8,175 IDs listed in a separate file.  I *think* that I managed 
>to create an
>index of all 200,000 probes in the original fasta file using 
>the following
>script:
>
>#!/usr/bin/perl -w
>
> # script 1: create the index
>
> use Bio::Index::Fasta;
> use strict;
> my $Index_File_Name = shift;
> my $inx = Bio::Index::Fasta->new(
>     -filename => $Index_File_Name,
>     -write_flag => 1);
> $inx->make_index(@ARGV);
>
>I'm not sure if this is the most sensible approach, and even 
>if it is, I'm
>not sure what to do next.  Any help would be greatly appreciated!
>
>Many thanks,
>Mike O.
>
>
>
>
>--
>No virus found in this outgoing message.
>Checked by AVG Free Edition.
>Version: 7.1.394 / Virus Database: 268.8.3/359 - Release Date: 6/8/2006
>
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l at lists.open-bio.org
>http://lists.open-bio.org/mailman/listinfo/bioperl-l
>




More information about the Bioperl-l mailing list