[Bioperl-l] NO BLAST

Luba Pardo lubapardo at gmail.com
Fri Dec 15 11:39:11 EST 2006


*Hello,*
*I am having trouble to use the module Bio::Tools::Run::StandAloneBlast;*
**
*I got the following error message: cannot find path to blastall.*
*The code I used is (modified from HOWTObeginners):
*

#! /local/bin/perl -w

#use strict;

use Bio::Seq; use Bio::SeqIO; use Bio::DB::GenBank; use
Bio::Tools::Run::StandAloneBlast;

my $db_object = Bio::DB::GenBank-> new;

#my $seq_ob = $db_object->get_Seq_by_id('NM_004043');

#$seq= Bio::SeqIO->new(-file => "> out.fasta", -format => 'fasta');

#$seq ->write_seq($seq_ob);

#print $seq;

@params = (program =>'blastn',
   database =>'db.fa');

$blast_obj =Bio::Tools::Run::StandAloneBlast->new(@params);


$seq_obj = Bio::Seq->new(-id =>"testquery",
   -seq =>"TTTAAATATATTTTGAAGTATAGATTATATGTT");

$report_obj = $blast_obj->blastall($seq_obj);

$result_obj =$report_obj->next_result;

print $result_obj->num_hits;

*Whether I create a sequence the novo or retrieve one from internet I got
the same message.*



More information about the Bioperl-l mailing list