[Bioperl-l] StandAlone BLAST on Windows???

[Alexander Kozik]

It looks as a query file was located on
-i  C:\DOCUME~1\Home\LOCALS~1\Temp\QZwYdo9eKx
"Documents and Settings" Windows directory.
NCBI BLAST on windows does not understand white spaces in file names and 
folders/directories. Removing of white space(s) from file names and 
directories may solve the problem. Also, pay attention to the short 
style "DOCUME~1" of these names in this particular report.

Alexander Kozik
Bioinformatics Specialist
Genome and Biomedical Sciences Facility
451 East Health Sciences Drive
University of California
Davis, CA 95616-8816
Phone: (530) 754-9127
email#1: akozik at atgc.org
email#2: akozik at gmail.com
web: http://www.atgc.org/


Bornman, Daniel M wrote:
> All that you have asked about is in place.
> 
> 
> 1) My PATH variable is set to 'C:\BLASTDB\bin\'
> 
> 
> 2) the 'ncbi.ini' file is in the C:\WINDOWS directory
> The contents of this file are:
> 
> [NCBI]
> Data=C:\BLASTDB\data 
> 
> 
> 3) I formatted the ecoli.nt database with the following command in the
> DOS prompt...
> 
> formatdb -i ecoli.nt -p F -o T
> 
> ...this generated 7 files in the C:\BLASTDB\data\ directory.
> (I can generate a Blast output with the following command..."blastall -p
> blastn -d ecoli.nt -i test.txt -o test.out")
> 
> 
> 
> 4) I also tried running the script after commenting out the
> "$ENV{BLASTDIR} = 'C:\\BLASTDB\\data';" section
> 
> 
> 
> BUPKIS...
> 
> 
> 
> HAS ANYONE HERE EVER TRIED AND HAD SUCCESS USING 'StandAloneBlast' ON
> WINDOWS?
> 
> 
> 
> 
> 
> 
> 
> -----Original Message-----
> From: Chris Fields [mailto:cjfields at uiuc.edu] 
> Sent: Friday, April 21, 2006 1:16 PM
> To: Bornman, Daniel M; bioperl-l at lists.open-bio.org
> Subject: RE: [Bioperl-l] StandAlone BLAST on Windows???
> 
> Do you have the database formatted and are your env variables set
> correctly in the ncbi.ini file?  From this output,
> 
> [NULL_Caption] WARNING: testquery: Unable to open ecoli.nt.nin
> 
> it looks like blastall couldn't find the properly formatted database
> (env variable not set correctly) or that the database doesn't exist
> (need to format using formatdb).  If I remember correctly, the directory
> containing your data in your ncbi.ini file (I placed mine in the
> C:\Windows dir) should look something like this:
> 
> [NCBI]
> Data=C:\Research\blast\data
> 
> You might also want to try leaving out the BLASTDIR if it is already set
> in ncbi.ini.  If you can't get it working I'll look into it (unless
> Torsten has WinXP????). 
> 
> Christopher Fields
> Postdoctoral Researcher - Switzer Lab
> Dept. of Biochemistry
> University of Illinois Urbana-Champaign 
> 
> 
>> -----Original Message-----
>> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l- 
>> bounces at lists.open-bio.org] On Behalf Of Bornman, Daniel M
>> Sent: Friday, April 21, 2006 11:50 AM
>> To: bioperl-l at lists.open-bio.org
>> Subject: [Bioperl-l] StandAlone BLAST on Windows???
>>
>> Dear BioPerl Listers,
>>
>> Does anyone know if the BioPerl StandAloneBlast module works on
> Windows?
>> I have a very simple script that will not work correctly.
>>
>> My PATH is set to 'C:\BLASTDB\bin'
>> My database, 'ecoli.nt' is in 'C:\BLASTDB\data' directory
>>
>> Here is the script:
>>
>> ## START ##
>>
>> BEGIN{
>> $ENV{BLASTDIR} = 'C:\\BLASTDB\\data';
>> }
>> use strict;
>> use Bio::Seq;
>> use Bio::Tools::Run::StandAloneBlast;
>>
>> my @params = (program  => 'blastn', database => 'ecoli.nt'); my 
>> $blast_obj = Bio::Tools::Run::StandAloneBlast->new(@params);
>> my $seq_obj = Bio::Seq->new(-id  =>"testquery", -seq 
>> =>"TTTAAATATATTTTGAAGTATAGATTATATGTT");
>> my $report_obj = $blast_obj->blastall($seq_obj); my $result_obj = 
>> $report_obj->next_result; print $result_obj->num_hits;
>>
>> ## END ##
>>
>>
>> Here is the error message I get:
>>
>> [NULL_Caption] WARNING: testquery: Unable to open ecoli.nt.nin
>>
>> ------------- EXCEPTION  -------------
>> MSG: blastall call crashed: 256 C:\BLASTDB\bin\blastall.exe -p  blastn
> 
>> -d  "\ecoli.nt"  -i  C:\DOCUME~1\Home\LOCALS~1\Temp\QZwYdo9eKx  -o 
>> C:\DOCUME~1\Home\LOCALS~1\Temp\ADP2OcZw8z
>>
>> STACK Bio::Tools::Run::StandAloneBlast::_runblast
>> C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:732
>> STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast
>> C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:680
>> STACK Bio::Tools::Run::StandAloneBlast::blastall
>> C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:536
>> STACK toplevel localblast.pl:12
>>
>> --------------------------------------
>>
>>
>> Thank You,
>>
>> Daniel Bornman
>> Researcher
>> Battelle Memorial Institute
>> 505 King Ave
>> Columbus, OH 43201
>> 614.424.3229
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l