[Bioperl-l] Question about script bp_pairwise_kaks.pl

[Jason Stajich]

I added an extra printing line so that you get the error string printed
from the program.  CVS update and run with -v.

The answer is
"74 nucleotides, not a multiple of 3!"

jason at jason $ perl ~/bioperl/core/scripts/utilities/pairwise_kaks.PLS -i
test.fa  -v
Program /sw/bin/clustalw
clustal command = /sw/bin/clustalw align
-infile=/tmp/14klOIck6A/ad454zhVxR -output=gcg
-outfile=/tmp/14klOIck6A/rNoHgThMfU


 CLUSTAL W (1.83) Multiple Sequence Alignments



Sequence format is Pearson
Sequence 1: F02.5_2          25 aa
Sequence 2: CBG29_2          25 aa
Start of Pairwise alignments
Aligning...
Sequences (1:2) Aligned. Score:  92
Guide tree        file created:   [/tmp/14klOIck6A/ad454zhVxR.dnd]
Start of Multiple Alignment
There are 1 groups
Aligning...
Group 1: Sequences:   2      Score:530
Alignment Score 139
GCG-Alignment file created      [/tmp/14klOIck6A/rNoHgThMfU]

-------------------- WARNING ---------------------
MSG: There was an error - see error_string for the program output
STACK Bio::Tools::Run::Phylo::PAML::Codeml::run
/Users/jason/Development/bioperl/run/Bio/Tools/Run/Phylo/PAML/Codeml.pm:482
STACK toplevel
/Users/jason/bioperl/core/scripts/utilities/pairwise_kaks.PLS:171going to
remove files /tmp/L6EOACFn53/MIFMS7A0jq
gaps are removed for pairwise comparison.

74 nucleotides, not a multiple of 3!
going to remove files /tmp/L6EOACFn53/MIFMS7A0jq
going to remove files /tmp/L6EOACFn53/MIFMS7A0jq
going to remove files
/tmp/14klOIck6A/ad454zhVxR,/tmp/14klOIck6A/rNoHgThMfU


On Tue, 6 Jul 2004, Jack Chen wrote:

> Hi,
>
> When I run the script for the following pair of sequences, the program
> dumped the following message:
>
> ------------- EXCEPTION Bio::Root::NotImplemented -------------
> MSG: Unknown format of PAML output
> STACK Bio::Tools::Phylo::PAML::_parse_summary
> /usr/lib/perl5/site_perl/5.6.0/Bio/Tools/Phylo/PAML.pm:359
> STACK Bio::Tools::Phylo::PAML::next_result
> /usr/lib/perl5/site_perl/5.6.0/Bio/Tools/Phylo/PAML.pm:224
> STACK toplevel /usr/bin/bp_pairwise_kaks.pl:177
>
> I know that these sequence don't contain internal stop codons. could
> someone explain what does this mean? I used codeml.
>
> Thanks
>
> Jack
>
> =-======================================================-=
>
> >F02.5_2
> agtggttaccttctactgggctatcatgcaaaaccaactttattccaaaccaacacaattgttccaatgaatgg
> >CBG29_2
> agtggttatttacttctggggtaccattccaaacccacactattccaaactaacactattgtacccatgactgg
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu