[Bioperl-l] Extracting Raw Score Value from Blast Output

[Waibhav Tembe]

Hello,

I am relatively new to BLAST and BioPerl. Apologies if this 
question/observation is trivial or I have made any basic mistake.

I am parsing BLAST output using *bioperl-1.4::Bio::Search::Hit* <toc.html>.
For a given hit, I would like to extract raw score, bit score and other 
information. Using
->raw_score
->Bits
for a hit. Here is what I observed. (Just pasting relevant info from 
BLAST output)
================================================
Query= PA008
        (35 letters)
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
          2,718,617 sequences; 12,254,801,043 total letters
Searching..................................................done
                                                                Score    E
Sequences producing significant alignments:                      (bits) 
Value
gb|CP000001.1| Bacillus cereus ZK, complete genome                     
70   2e-10
omitted all other records ..........
 >gb|CP000001.1| Bacillus cereus ZK, complete genome
         Length = 5300915
Score = 69.9 bits (35), Expect = 2e-10
Identities = 35/35 (100%)
Strand = Plus / Plus
Query: 1       ttaacgaagcatcgcgaagagcacgttcaattgga 35
              |||||||||||||||||||||||||||||||||||
Sbjct: 3032643 ttaacgaagcatcgcgaagagcacgttcaattgga 3032677
---------------------------------------------
For the above BLAST section, I generated the following statistics using 
BioPerl.
Query Name = PA008
Lambda=1.37, Kappa=0.711, Base Match Reward=1
Checking Hit [1]Raw Score=      70      BitScore=69.9   EValue=2e-10    
Bacillus cereus ZK, complete genome

I was expecting Raw Score = 35 and NOT 70.  Is raw_score output by 
BioPerl's implementation calculated differently? Am I reading BLAST 
output incorreclty?

Thanks!

-waibhav

-- 
Waibhav Tembe.