[Bioperl-l] Help w/ AlignIO and consensus_iupac

[gadbermd at earthlink.net]

Hi everyone,

I am a BioPerl newbie and I was wondering if someone could help me figure out how to generate a consensus from a Clustalw .aln file? I tried to write this sample code:

#!/usr/bin/perl
use warnings;
use Bio::AlignIO;

my $usage = "Usage: test.pl <in_file> \n";
my $in_file = shift or die $usage;

$alignio = new Bio::AlignIO(-format => 'clustalw', -file => "$in_file");
$aln = $alignio->next_aln();
$str = $aln->consensus_iupac();

print $str;


But it always generates an error message saying the sequence is a protein:


% ./test.pl new.aln
------------- EXCEPTION  -------------
MSG: Seq [gi|18397816|ref|NM_102852.1|/1-648] is a protein
STACK Bio::SimpleAlign::consensus_iupac /usr/lib/perl5/site_perl/5.8.0/Bio/SimpleAlign.pm:1325
STACK toplevel ./test.pl:9

--------------------------------------


This occurs in spite of the fact that the Clustal output is all nucleotides, not proteins...



% cat new.aln
CLUSTAL W (1.82) multiple sequence alignment


gi|18397816|ref|NM_102852.1|      --------------------------------------------------
gi|33242920|gb|AY332478.1|        GGTTAATTTTGGTTGGAGGTAGAGAGAGAGAGAGAGGGAGGGAGGGAGGA
gi|18424168|ref|NM_125279.1|      --------------------------------------------------



gi|18397816|ref|NM_102852.1|      -----------------ATGAGG--AAAGGTAAGAGAGTGATA-------
gi|33242920|gb|AY332478.1|        GGAGGAGGAGGAGGAGGAGGAGG--AAGAACAGGAGGAAGATGGGGCGGG
gi|18424168|ref|NM_125279.1|      -----------------ATGGTTCCGAAAGTGGTCGACCTACA-------
                                                   * *      *        *    *

etc. etc. etc.


I have tried it with a number of different Clustal output files but it always complains about them containing proteins.  I figure I have to be doing something wrong here. 

Thanks so much,
Mike G.