[Bioperl-l] New code
Chris Mungall
cjm@fruitfly.bdgp.berkeley.edu
Sun, 13 Jan 2002 16:18:47 -0800 (PST)
I have committed scripts/bioperl.pl
(name isn't final, just wanted to get the code out there; also not sure
about the whole release schedule thing - should it be rolled back for that
as it's still unfinished code)
this is a command line interface to bioperl, the easiest way to get a
handle on it is to fire it up and type "demo"
still a ways to go yet but you should get the basic idea
I didn't make much use of Bio::Perl as I needed some really hacky
subroutines that play around with global variables (I know they're
generally evil but I think it's justified in this context)
On Mon, 31 Dec 2001, Ewan Birney wrote:
>
> Chris - that would be great - this sort of "easy access" can work for a
> whole series of users as you mention.
>
>
> I have just commit'ed the start of Bio::Perl object - do you want to add
> to it?
>
>
> We should not add the BLAST parsing stuff until Jason tells us the "one
> blast parser to rule them all"
>
>
>
> I've attached the pod2text of Bio::Perl so far - newbies on the list
> (Elizabeth? Others?) does this look good to you?
>
>
>
> NAME
> Bio::Perl - Functional access to BioPerl for people who don't
> like objects
>
> SYNOPSIS
> use Bio::Perl qw(read_sequence read_all_sequences write_sequence new_sequence get_sequence);
>
> # will guess file format from extension
> $seq_object = read_sequence($filename);
>
> # forces genbank format
> $seq_object = read_sequence($filename,'genbank');
>
> # reads an array of sequences
> @seq_object_array = read_all_sequences($filename,'fasta');
>
> # sequences are Bio::Seq objects, so the following methods work
> # (for more info see Bio::Seq documentation - try perldoc Bio::Seq)
>
> print "Sequence name is ",$seq_object->display_id,"\n";
> print "Sequence acc is ",$seq_object->accession_number,"\n";
> print "First 5 bases is ",$seq_object->subseq(1,5),"\n";
>
> # get the whole sequence as a single string
>
> $sequence_as_a_string = $seq_object->seq();
>
> # writing sequences
>
> write_sequence(">$filename",'genbank',$seq_object);
>
> write_sequence(">$filename",'genbank',@seq_object_array);
>
> # making a new sequence from just strings you have
> # from something else
>
> $seq_object = new_sequence("ATTGGTTTGGGGACCCAATTTGTGTGTTATATGTA","myname","AL12232");
>
> # getting a sequence from a database (assummes internet connection)
>
> $seq_object = get_sequence('swissprot',"ROA1_HUMAN");
>
> $seq_object = get_sequence('embl',"AI129902");
>
> $seq_object = get_sequence('genbank',"AI129902");
>
> DESCRIPTION
> Easy first time access to BioPerl via functions
>
> FEEDBACK
> Mailing Lists
>
> User feedback is an integral part of the evolution of this and
> other Bioperl modules. Send your comments and suggestions
> preferably to one of the Bioperl mailing lists. Your
> participation is much appreciated.
>
> bioperl-l@bio.perl.org
>
> Reporting Bugs
>
> Report bugs to the Bioperl bug tracking system to help us keep
> track the bugs and their resolution. Bug reports can be
> submitted via email or the web:
>
> bioperl-bugs@bio.perl.org
> http://bio.perl.org/bioperl-bugs/
>
> AUTHOR - Ewan Birney
> Email bioperl-l@bio.perl.org
>
> Describe contact details here
>
> APPENDIX
> The rest of the documentation details each of the object
> methods. Internal methods are usually preceded with a _
>
> read_sequence
>
> Title : read_sequence
> Usage : $seq = read_sequence('sequences.fa')
> $seq = read_sequence($filename,'genbank');
>
> # pipes are fine
> $seq = read_sequence("my_fetching_program $id |",'fasta');
>
> Function: Reads the top sequence from the file. If no format is given, it will
> try to guess the format from the filename. If a format is given, it
> forces that format. The filename can be any valid perl open() string
> - in particular, you can put in pipes
>
> Returns : A Bio::Seq object - see perldoc Bio::Seq for more information
> (quick synopsis -
> $seq_object->display_id - name of the sequence
> $seq_object->seq - sequence as a string )
>
> Args : Two strings, first the filename - any Perl open() string is ok
> Second string is the format, which is optional
>
> read_all_sequences
>
> Title : read_all_sequences
> Usage : @seq_object_array = read_all_sequences($filename);
> @seq_object_array = read_all_sequences($filename,'genbank');
>
> Function: Just as the function above, but reads all the sequences in the
> file and loads them into an array.
>
> For very large files, you will run out of memory. When this
> happens, you've got to use the SeqIO system directly (this is
> not so hard! Don't worry about it!). See perldoc Bio::SeqIO
> for more information
>
> Returns : array of Bio::Seq objects
>
> Args : two strings, first the filename (any open() string is ok)
> second the format (which is optional)
>
> write_sequence
>
> Title : write_sequence
> Usage : write_sequence(">new_file.gb",'genbank',$seq)
> write_sequence(">new_file.gb",'genbank',@array_of_sequence_objects)
>
> Function: writes sequences in the specified format,
>
> Returns : Nothing
>
> Args : filename as a string, must provide an open() output file
> format as a string
> one or more sequence objects
>
> new_sequence
>
> Title : new_sequence
> Usage :
> Function:
> Example :
> Returns :
> Args :
>
> get_sequence
>
> Title : get_sequence
> Usage : $seq_object = get_sequence('swiss',"ROA1_HUMAN");
>
> Function: If the computer has internet accessibility, gets
> the sequence from internet accessible databases. Currently
> this supports Swissprot, EMBL and GenBank.
>
> Swissprot and EMBL are more robust than GenBank fetching
>
> Returns : A Bio::Seq object
>
> Args : database type - one of swiss, embl or genbank
> identifier or accession number
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@bioperl.org
> http://bioperl.org/mailman/listinfo/bioperl-l
>