[Biojava-l] translation and leucine
    François Le Fèvre 
    flf.mib at gmail.com
       
    Sat Apr 23 06:12:53 UTC 2011
    
    
  
Andy
ok, perfect I did not know it!
Thanks
Francois
> Hi Francois,
>
> The engine by default will always return the first amino acid as an init met if the amino acid could have been a start codon (but stupid atmo but it will be altered). If you do not want this behaviour then you'll have to create your own. You can do this using the following:
>
> TranscriptionEngine e = new TranscriptionEngine.Builder().initMet(false).build();
>
> HTH,
>
> Andy
>
> On 21 Apr 2011, at 22:18, François Le Fèvre wrote:
>
>> Dear all,
>> i have a quick question about translation with biojava 3
>>
>> I would like to retrieve that the codon CTA is coding for a leucine.
>> But some leucine codons code also for a start in Universal Genetic code
>>
>> Here I have build a very short example:
>> given  a short dna sequence coomposed of a start codon and 6 leucine codons
>>
>> TranscriptionEngine e = TranscriptionEngine.getDefault();
>> DNASequence dd = new DNASequence("ATGTTGTTACTTCTCCTACTG");
>> //return MLLLLLL : OK
>>
>> DNASequence dd = new DNASequence("CTATTGTTACTTCTCCTACTG");
>> //return MLLLLLL : KO I would prefer have LLLLLLL !
>>
>> DNASequence dd = new DNASequence("CTA");
>> //return M : KO I would prefer have L !
>>
>> Could someone explain me this feature ?
>> How the default transcritionEngine works?
>>
>> How can I ask to the TranscriptionEngine give me the aminoacids corresponding to CTA when it is not in first position?
>>
>> Thanks a lot for your help !
>>
>> Francois
>>
>> _______________________________________________
>> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/biojava-l
    
    
More information about the Biojava-l
mailing list