[Biojava-l] Rendering Questions

[Thomas Down]

On Mon, Jan 13, 2003 at 04:52:14AM -0800, Ethan Cerami wrote:
>
> Right now, I am just modifying the code to display
> exons.  The complete code is below.  And, I am using
> the following jar file:  biojava-20020823.jar.

If you're using that snapshot, you might want to update
to the latest and greatest code from http://cvs.open-bio.org/

> Here are my questions:
> 
> 1.  I am using the ZiggyFeatureRenderer, and I had
> expected to see boxes separated by ziggy lines,
> therefore indicating exons and introns.  But, I don't
> see any ziggy lines, just boxes.  What am I doing
> wrong?

ZiggyFeatureRenderer can't magically work out how to
group your exons together.  What it actually does it
render features with non-contiguous locations in the
`tented exons' style.

Try:

    StrandedFeature.Template temp = new StrandedFeature.Template();
    temp.type = "transcript";
    temp.source = "just_testing";
    temp.location = LocationTools.union(
        new RangeLocation(10, 20),
        new RangeLocation(50, 60)
    );
    temp.annotation = Annotation.EMPTY_ANNOTATION;
    temp.strand = StrandedFeature.POSITIVE

> 2.  I want to be able to render the same features
> without having its actual sequence.  How do I do this?

Do you just want to remove the sequence line from the
display?  In this case, just remove the line:

   mlr.addRenderer(seqR);

If you want to draw some boxes on the screen without
knowing the sequence *at all*, I've found some code like
this works well:

    SymbolList dummySL = new DummySymbolList(
        DNATools.getDNA(),
        1000
    );
    Sequence dummySeq = new SimpleSequence(
        dummySL,
        "foo",
        "bar",
        Annotation.EMPTY_ANNOTATION
    );
    // construct features on dummySeq

Hope this helps,

     Thomas.


> Any help would be most appreciated.
> 
> Ethan Cerami
> 
> Code follows below:
> ----------------------------------------
> 
> import java.awt.*;
> import java.awt.event.*;
> 
> import javax.swing.*;
> 
> import org.biojava.bio.*;
> import org.biojava.bio.gui.sequence.*;
> import org.biojava.bio.seq.*;
> import org.biojava.bio.seq.genomic.Exon;
> import org.biojava.bio.symbol.*;
> 
> public class FeatureView extends JFrame {
> 	private Sequence seq;
> 	private JPanel jPanel = new JPanel();
> 
> 	private MultiLineRenderer mlr = new
> MultiLineRenderer();
> 	private ZiggyFeatureRenderer featr = new
> ZiggyFeatureRenderer();
> 	private SequenceRenderer seqR = new
> SymbolSequenceRenderer();
> 	private RulerRenderer ruler = new RulerRenderer();
> 
> 	private SequencePanel seqPanel = new SequencePanel();
> 	//the proxy between featr and seqPanel
> 	private FeatureBlockSequenceRenderer fbr = new
> FeatureBlockSequenceRenderer();
> 
> 	public FeatureView() {
> 		try {
> 			seq = DNATools.createDNASequence(
> 					"atcgcgcatgcgcgcgcgcgcgcgctttatagcgatagagatata",
> 					"dna 1");
> 
> 			// create multiple exons
> 			for (int i=10; i<=30; i+=10) {
> 				Exon.Template exon = new Exon.Template();
> 				exon.annotation = Annotation.EMPTY_ANNOTATION;
> 				exon.location = new RangeLocation(i, i+5);
> 				exon.strand = StrandedFeature.POSITIVE;
> 				seq.createFeature(exon);
> 			}
> 			//setup GUI
> 			init();
> 		} catch (Exception e) {
> 			e.printStackTrace();
> 		}
> 	}
> 
> 	public static void main(String[] args) {
> 		FeatureView featureView = new FeatureView();
> 		featureView.pack();
> 		featureView.show();
> 	}
> 
> 	/**
> 	 * initialize GUI components
> 	 */
> 	private void init() throws Exception {
> 		this.setTitle("FeatureView");
> 		this.getContentPane().add(jPanel,
> BorderLayout.CENTER);
> 		jPanel.add(seqPanel, null);
> 
> 		//Register the FeatureRenderer with the
> FeatureBlockSequenceRenderer
> 		fbr.setFeatureRenderer(featr);
> 
> 		//add Renderers to the MultiLineRenderer
> 		mlr.addRenderer(fbr);
> 		mlr.addRenderer(seqR);
> 		mlr.addRenderer(ruler);
> 
> 		//set the MultiLineRenderer as the SequencePanels
> renderer
> 		seqPanel.setRenderer(mlr);
> 
> 		//set the Sequence to Render
> 		seqPanel.setSequence(seq);
> 
> 		//display the whole Sequence
> 		seqPanel.setRange(new RangeLocation(1,
> seq.length()));
> 	}
> 
> 	/**
> 	 * Overridden so program terminates when window
> closes
> 	 */
> 	protected void processWindowEvent(WindowEvent we) {
> 		if (we.getID() == WindowEvent.WINDOW_CLOSING) {
> 			System.exit(0);
> 		} else {
> 			super.processWindowEvent(we);
> 		}
> 	}
> }
> 
> 
> 
> 
> __________________________________________________
> Do you Yahoo!?
> Yahoo! Mail Plus - Powerful. Affordable. Sign up now.
> http://mailplus.yahoo.com
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l@biojava.org
> http://biojava.org/mailman/listinfo/biojava-l