From mmuratet at hudsonalpha.org Sun Jan 8 11:57:35 2012 From: mmuratet at hudsonalpha.org (Michael Muratet) Date: Sun, 8 Jan 2012 10:57:35 -0600 Subject: [EMBOSS] Pipe not working Message-ID: <391A384B-B3CD-4F84-8595-A37013D77B7B@hudsonalpha.org> Greetings It seems like this should work: $ echo "GATACTAATTGCCCGTGAGGCTTGA" | palindrome -filter Error: Unable to read sequence 'stdin' Died: palindrome terminated: Bad value for '-sequence' with -auto defined and yet as you can see, it does not. I haven't used it for awhile, but I recall it used to work. I've searched the docs and tried all the permutations on the command I can think of and I'm getting nowhere. Does anyone see a problem with the command or have a suggestion where to search for a problem? Thanks Mike Michael Muratet, Ph.D. Senior Scientist HudsonAlpha Institute for Biotechnology mmuratet at hudsonalpha.org (256) 327-0473 (p) (256) 327-0966 (f) Room 4005 601 Genome Way Huntsville, Alabama 35806 From david.bauer at bayer.com Mon Jan 9 01:58:50 2012 From: david.bauer at bayer.com (david.bauer at bayer.com) Date: Mon, 9 Jan 2012 07:58:50 +0100 Subject: [EMBOSS] Antwort: Pipe not working In-Reply-To: <391A384B-B3CD-4F84-8595-A37013D77B7B@hudsonalpha.org> Message-ID: Hi Mike, if you send a plain sequence via stdin to an EMBOSS program, you must explicitly specify the sequence format as "plain". echo "GATACTAATTGCCCGTGAGGCTTGA" | palindrome -filter -sformat plain David. emboss-bounces at lists.open-bio.org schrieb am 08/01/2012 17:57:35: > Greetings > > It seems like this should work: > > $ echo "GATACTAATTGCCCGTGAGGCTTGA" | palindrome -filter > Error: Unable to read sequence 'stdin' > Died: palindrome terminated: Bad value for '-sequence' with -auto > defined > > and yet as you can see, it does not. I haven't used it for awhile, but > I recall it used to work. > > I've searched the docs and tried all the permutations on the command I > can think of and I'm getting nowhere. > > Does anyone see a problem with the command or have a suggestion where > to search for a problem? > > Thanks > > Mike > > Michael Muratet, Ph.D. > Senior Scientist > HudsonAlpha Institute for Biotechnology > mmuratet at hudsonalpha.org > (256) 327-0473 (p) > (256) 327-0966 (f) > > Room 4005 > 601 Genome Way > Huntsville, Alabama 35806 > > > > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss From mmuratet at hudsonalpha.org Mon Jan 9 10:14:10 2012 From: mmuratet at hudsonalpha.org (Michael Muratet) Date: Mon, 9 Jan 2012 09:14:10 -0600 Subject: [EMBOSS] Antwort: Pipe not working In-Reply-To: References: Message-ID: On Jan 9, 2012, at 12:58 AM, david.bauer at bayer.com wrote: > > Hi Mike, > > if you send a plain sequence via stdin to an EMBOSS program, you > must explicitly specify the sequence format as "plain". > > echo "GATACTAATTGCCCGTGAGGCTTGA" | palindrome -filter -sformat plain > > David. Thanks, David. That was the problem. Mike > emboss-bounces at lists.open-bio.org schrieb am 08/01/2012 17:57:35: > > > Greetings > > > > It seems like this should work: > > > > $ echo "GATACTAATTGCCCGTGAGGCTTGA" | palindrome -filter > > Error: Unable to read sequence 'stdin' > > Died: palindrome terminated: Bad value for '-sequence' with -auto > > defined > > > > and yet as you can see, it does not. I haven't used it for awhile, > but > > I recall it used to work. > > > > I've searched the docs and tried all the permutations on the > command I > > can think of and I'm getting nowhere. > > > > Does anyone see a problem with the command or have a suggestion > where > > to search for a problem? > > > > Thanks > > > > Mike > > > > Michael Muratet, Ph.D. > > Senior Scientist > > HudsonAlpha Institute for Biotechnology > > mmuratet at hudsonalpha.org > > (256) 327-0473 (p) > > (256) 327-0966 (f) > > > > Room 4005 > > 601 Genome Way > > Huntsville, Alabama 35806 > > > > > > > > > > > > _______________________________________________ > > EMBOSS mailing list > > EMBOSS at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/emboss Michael Muratet, Ph.D. Senior Scientist HudsonAlpha Institute for Biotechnology mmuratet at hudsonalpha.org (256) 327-0473 (p) (256) 327-0966 (f) Room 4005 601 Genome Way Huntsville, Alabama 35806 From mmuratet at hudsonalpha.org Sun Jan 8 16:57:35 2012 From: mmuratet at hudsonalpha.org (Michael Muratet) Date: Sun, 8 Jan 2012 10:57:35 -0600 Subject: [EMBOSS] Pipe not working Message-ID: <391A384B-B3CD-4F84-8595-A37013D77B7B@hudsonalpha.org> Greetings It seems like this should work: $ echo "GATACTAATTGCCCGTGAGGCTTGA" | palindrome -filter Error: Unable to read sequence 'stdin' Died: palindrome terminated: Bad value for '-sequence' with -auto defined and yet as you can see, it does not. I haven't used it for awhile, but I recall it used to work. I've searched the docs and tried all the permutations on the command I can think of and I'm getting nowhere. Does anyone see a problem with the command or have a suggestion where to search for a problem? Thanks Mike Michael Muratet, Ph.D. Senior Scientist HudsonAlpha Institute for Biotechnology mmuratet at hudsonalpha.org (256) 327-0473 (p) (256) 327-0966 (f) Room 4005 601 Genome Way Huntsville, Alabama 35806 From david.bauer at bayer.com Mon Jan 9 06:58:50 2012 From: david.bauer at bayer.com (david.bauer at bayer.com) Date: Mon, 9 Jan 2012 07:58:50 +0100 Subject: [EMBOSS] Antwort: Pipe not working In-Reply-To: <391A384B-B3CD-4F84-8595-A37013D77B7B@hudsonalpha.org> Message-ID: Hi Mike, if you send a plain sequence via stdin to an EMBOSS program, you must explicitly specify the sequence format as "plain". echo "GATACTAATTGCCCGTGAGGCTTGA" | palindrome -filter -sformat plain David. emboss-bounces at lists.open-bio.org schrieb am 08/01/2012 17:57:35: > Greetings > > It seems like this should work: > > $ echo "GATACTAATTGCCCGTGAGGCTTGA" | palindrome -filter > Error: Unable to read sequence 'stdin' > Died: palindrome terminated: Bad value for '-sequence' with -auto > defined > > and yet as you can see, it does not. I haven't used it for awhile, but > I recall it used to work. > > I've searched the docs and tried all the permutations on the command I > can think of and I'm getting nowhere. > > Does anyone see a problem with the command or have a suggestion where > to search for a problem? > > Thanks > > Mike > > Michael Muratet, Ph.D. > Senior Scientist > HudsonAlpha Institute for Biotechnology > mmuratet at hudsonalpha.org > (256) 327-0473 (p) > (256) 327-0966 (f) > > Room 4005 > 601 Genome Way > Huntsville, Alabama 35806 > > > > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss From mmuratet at hudsonalpha.org Mon Jan 9 15:14:10 2012 From: mmuratet at hudsonalpha.org (Michael Muratet) Date: Mon, 9 Jan 2012 09:14:10 -0600 Subject: [EMBOSS] Antwort: Pipe not working In-Reply-To: References: Message-ID: On Jan 9, 2012, at 12:58 AM, david.bauer at bayer.com wrote: > > Hi Mike, > > if you send a plain sequence via stdin to an EMBOSS program, you > must explicitly specify the sequence format as "plain". > > echo "GATACTAATTGCCCGTGAGGCTTGA" | palindrome -filter -sformat plain > > David. Thanks, David. That was the problem. Mike > emboss-bounces at lists.open-bio.org schrieb am 08/01/2012 17:57:35: > > > Greetings > > > > It seems like this should work: > > > > $ echo "GATACTAATTGCCCGTGAGGCTTGA" | palindrome -filter > > Error: Unable to read sequence 'stdin' > > Died: palindrome terminated: Bad value for '-sequence' with -auto > > defined > > > > and yet as you can see, it does not. I haven't used it for awhile, > but > > I recall it used to work. > > > > I've searched the docs and tried all the permutations on the > command I > > can think of and I'm getting nowhere. > > > > Does anyone see a problem with the command or have a suggestion > where > > to search for a problem? > > > > Thanks > > > > Mike > > > > Michael Muratet, Ph.D. > > Senior Scientist > > HudsonAlpha Institute for Biotechnology > > mmuratet at hudsonalpha.org > > (256) 327-0473 (p) > > (256) 327-0966 (f) > > > > Room 4005 > > 601 Genome Way > > Huntsville, Alabama 35806 > > > > > > > > > > > > _______________________________________________ > > EMBOSS mailing list > > EMBOSS at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/emboss Michael Muratet, Ph.D. Senior Scientist HudsonAlpha Institute for Biotechnology mmuratet at hudsonalpha.org (256) 327-0473 (p) (256) 327-0966 (f) Room 4005 601 Genome Way Huntsville, Alabama 35806