From hans at 013.net Wed Dec 8 09:19:35 2010 From: hans at 013.net (Hanan Sela) Date: Wed, 8 Dec 2010 16:19:35 +0200 Subject: [EMBOSS] Skipredundant problems Message-ID: Hello all I was looking for a software that will collapse 147 sequence into haplotypes. I have tried Skipredundant but somehow it returns much more haplotypes than expected. I have used one threshold of 99%. When I use 90% I get much less haplotypes than expected. To my understanding, every pair of haplotypes that are less similar than the threshold will be kept. Am I doing wrong? Is there another alternative to collapse into haplotypes? Thank you Hanan -- From twaddlac at gmail.com Tue Dec 14 13:33:36 2010 From: twaddlac at gmail.com (Alan Twaddle) Date: Tue, 14 Dec 2010 13:33:36 -0500 Subject: [EMBOSS] vectorstrip not finding match Message-ID: Hello, I am having some trouble getting vectorstrip to match the vector sequences with the sequence data. I have attached the vector file and some of my test data along with this message. I don't know if it is a formatting error or not but I am out of ideas for this one. However, I haven''t used this software before so I may be missing something, but I listed the command line arguments that I changed (those that are prompted but NOT listed below were kept as the default settings). Please let me know if you have any suggestions, thank you! Also, is there a way to trim quality files, too? vectorstrip -sequence L3-cDNA-500-PFU-clA-M13R.ab1.seq -vectorsfile pCR4TOPO.fasta -Show only the best hits? N <\CODE> -- Alan Twaddle, B.S. MUC class of 2010 -------------- next part -------------- A non-text attachment was scrubbed... Name: L3-cDNA-500-PFU-clA-M13R.ab1.seq Type: application/octet-stream Size: 1241 bytes Desc: not available URL: -------------- next part -------------- A non-text attachment was scrubbed... Name: pCR4-TOPO.fasta Type: application/octet-stream Size: 15884 bytes Desc: not available URL: From david.bauer at bayer.com Wed Dec 15 04:45:57 2010 From: david.bauer at bayer.com (david.bauer at bayer.com) Date: Wed, 15 Dec 2010 10:45:57 +0100 Subject: [EMBOSS] Antwort: vectorstrip not finding match Message-ID: Hi Alan, the vectorsfile for vectorstrip is not the vector sequence in fasta format but a file containing the 5' and 3' end sequences of the vector site, where the insert was cloned in. So for the pCR4-TOPO you need this in your vectorsfile: pCR4-TOPO agtcctgcaggtttaaacgaattcgccctt aagggcgaattcgcggccgctaaattcaat With this vectorsfile the program finds the vector in your sequence file: > vectorstrip -seq l3.fa -vectorsfile emboss_vectors.txt Sequence: L3-cDNA-500-PFU-clA-M13R.ab1 Vector: pCR4-TOPO 5' sequence matches: From 30 to 59 with 0 mismatches 3' sequence matches: From 540 to 569 with 0 mismatches Sequences output to file: from 60 to 539 TTAAAGAGGATCAGGTATTTTCTCCACGTGGTGCACGCAAAGCGAGTTGG TCGAGTGTAATTATTTCACCACCTGCTTTAATTATCCGTGCGCGAGCTCC TTTAGTCACATGCAGTGCAGCAACCGTAAGCTTGGGAATTTCAAAAATCC GATTATCATCTGTGATCGTCCCAACTACGACCGCTATTTTCGTTATATTA CCACCTCTTTTCATGTAACGTACCAAACGAGCAAGTGACATCGGTGGACG ATGGCGACGAGCCATCATTAATCTTTTCGTGATAATATTGTTGAATTTTT CACCGGTTTTCCGAGTCAAGTATTTGTATAACTTTACTAGGACTCGAAGA TACGGATCTTCACTTTTTGGTGCTTTACGCCGTACTTTACGGTCATTTTT ATGATTTATATCGATACCCATTTTTAATACTGGACTGCTCCCCCTCGCTA ATCCTGCACTCAAACTTGGGTAATTAAACC sequence trimmed from 5' end: GCGAACTAGATATCCTCACTAAAGGGACTAGTCCTGCAGGTTTAAACGAA TTCGCCCTT sequence trimmed from 3' end: AAGGGCGAATTCGCGGCCGCTAAATTCAATTCGCCCTATAGTGAGTCGTA TTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTG GCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGG CGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAG CCTATACGTACGGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTT ATCGTCTGTTTGTGGATGTACAGAGTGATATTATTGACACGCCGGGGCGA CGGATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTC CCGTGAACTTTACCCGGTGGTGCATATCGGGGATGAAAGCTGGCGCATGA TGACCACCGATATGGCCAGTGTGCCGGTCTCCGTTATCGGGGGAAGAAGT GGCTGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATTAAGCTGA TGTTCTGGGGAATATTAATGTCACGCATGAGATATCCAAAAAGGATCTTC CCCTAAATCCTTTTCTCGTATAAAGCCAGTCCGACAGAAAACCGGGGCTG ACCCCGGGATGAATGTCTCAACCCAACTGGGGGCAA Hope this helps, David. emboss-bounces at lists.open-bio.org schrieb am 14/12/2010 19:33:36: > Hello, > > I am having some trouble getting vectorstrip to match the vector > sequences with the sequence data. I have attached the vector file and some > of my test data along with this message. I don't know if it is a formatting > error or not but I am out of ideas for this one. However, I haven''t used > this software before so I may be missing something, but I listed the command > line arguments that I changed (those that are prompted but NOT listed below > were kept as the default settings). Please let me know if you have any > suggestions, thank you! > > Also, is there a way to trim quality files, too? > > > vectorstrip -sequence L3-cDNA-500-PFU-clA-M13R.ab1.seq -vectorsfile > pCR4TOPO.fasta > -Show only the best hits? N > <\CODE> > > -- > > Alan Twaddle, B.S. > MUC class of 2010 > [Anhang "L3-cDNA-500-PFU-clA-M13R.ab1.seq" gel?scht von David > Bauer/SGQRH/DE/BHC/BAYER] [Anhang "pCR4-TOPO.fasta" gel?scht von > David Bauer/SGQRH/DE/BHC/BAYER] > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss From nirvana.cmb at gmail.com Thu Dec 30 04:20:35 2010 From: nirvana.cmb at gmail.com (Yufei Yang) Date: Thu, 30 Dec 2010 17:20:35 +0800 Subject: [EMBOSS] question with Dan Message-ID: Hello everyone, I want to calculate the melting temperature (Tm) of RNA-DNA hybrid using EMBOSS dan. Dose the qualifier '-rna yes' means calculating RNA-DNA hybrid instead of RNA-RNA? Anybody can help me? Thank you very much for your time and attention. waiting for the response with warm regards -- Yufei Yang College of Life Sciences Beijing Normal University Beijing, 100875 P. R. China From hans at 013.net Wed Dec 8 14:19:35 2010 From: hans at 013.net (Hanan Sela) Date: Wed, 8 Dec 2010 16:19:35 +0200 Subject: [EMBOSS] Skipredundant problems Message-ID: Hello all I was looking for a software that will collapse 147 sequence into haplotypes. I have tried Skipredundant but somehow it returns much more haplotypes than expected. I have used one threshold of 99%. When I use 90% I get much less haplotypes than expected. To my understanding, every pair of haplotypes that are less similar than the threshold will be kept. Am I doing wrong? Is there another alternative to collapse into haplotypes? Thank you Hanan -- From twaddlac at gmail.com Tue Dec 14 18:33:36 2010 From: twaddlac at gmail.com (Alan Twaddle) Date: Tue, 14 Dec 2010 13:33:36 -0500 Subject: [EMBOSS] vectorstrip not finding match Message-ID: Hello, I am having some trouble getting vectorstrip to match the vector sequences with the sequence data. I have attached the vector file and some of my test data along with this message. I don't know if it is a formatting error or not but I am out of ideas for this one. However, I haven''t used this software before so I may be missing something, but I listed the command line arguments that I changed (those that are prompted but NOT listed below were kept as the default settings). Please let me know if you have any suggestions, thank you! Also, is there a way to trim quality files, too? vectorstrip -sequence L3-cDNA-500-PFU-clA-M13R.ab1.seq -vectorsfile pCR4TOPO.fasta -Show only the best hits? N <\CODE> -- Alan Twaddle, B.S. MUC class of 2010 -------------- next part -------------- A non-text attachment was scrubbed... Name: L3-cDNA-500-PFU-clA-M13R.ab1.seq Type: application/octet-stream Size: 1241 bytes Desc: not available URL: -------------- next part -------------- A non-text attachment was scrubbed... Name: pCR4-TOPO.fasta Type: application/octet-stream Size: 15884 bytes Desc: not available URL: From david.bauer at bayer.com Wed Dec 15 09:45:57 2010 From: david.bauer at bayer.com (david.bauer at bayer.com) Date: Wed, 15 Dec 2010 10:45:57 +0100 Subject: [EMBOSS] Antwort: vectorstrip not finding match Message-ID: Hi Alan, the vectorsfile for vectorstrip is not the vector sequence in fasta format but a file containing the 5' and 3' end sequences of the vector site, where the insert was cloned in. So for the pCR4-TOPO you need this in your vectorsfile: pCR4-TOPO agtcctgcaggtttaaacgaattcgccctt aagggcgaattcgcggccgctaaattcaat With this vectorsfile the program finds the vector in your sequence file: > vectorstrip -seq l3.fa -vectorsfile emboss_vectors.txt Sequence: L3-cDNA-500-PFU-clA-M13R.ab1 Vector: pCR4-TOPO 5' sequence matches: From 30 to 59 with 0 mismatches 3' sequence matches: From 540 to 569 with 0 mismatches Sequences output to file: from 60 to 539 TTAAAGAGGATCAGGTATTTTCTCCACGTGGTGCACGCAAAGCGAGTTGG TCGAGTGTAATTATTTCACCACCTGCTTTAATTATCCGTGCGCGAGCTCC TTTAGTCACATGCAGTGCAGCAACCGTAAGCTTGGGAATTTCAAAAATCC GATTATCATCTGTGATCGTCCCAACTACGACCGCTATTTTCGTTATATTA CCACCTCTTTTCATGTAACGTACCAAACGAGCAAGTGACATCGGTGGACG ATGGCGACGAGCCATCATTAATCTTTTCGTGATAATATTGTTGAATTTTT CACCGGTTTTCCGAGTCAAGTATTTGTATAACTTTACTAGGACTCGAAGA TACGGATCTTCACTTTTTGGTGCTTTACGCCGTACTTTACGGTCATTTTT ATGATTTATATCGATACCCATTTTTAATACTGGACTGCTCCCCCTCGCTA ATCCTGCACTCAAACTTGGGTAATTAAACC sequence trimmed from 5' end: GCGAACTAGATATCCTCACTAAAGGGACTAGTCCTGCAGGTTTAAACGAA TTCGCCCTT sequence trimmed from 3' end: AAGGGCGAATTCGCGGCCGCTAAATTCAATTCGCCCTATAGTGAGTCGTA TTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTG GCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGG CGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAG CCTATACGTACGGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTT ATCGTCTGTTTGTGGATGTACAGAGTGATATTATTGACACGCCGGGGCGA CGGATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTC CCGTGAACTTTACCCGGTGGTGCATATCGGGGATGAAAGCTGGCGCATGA TGACCACCGATATGGCCAGTGTGCCGGTCTCCGTTATCGGGGGAAGAAGT GGCTGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATTAAGCTGA TGTTCTGGGGAATATTAATGTCACGCATGAGATATCCAAAAAGGATCTTC CCCTAAATCCTTTTCTCGTATAAAGCCAGTCCGACAGAAAACCGGGGCTG ACCCCGGGATGAATGTCTCAACCCAACTGGGGGCAA Hope this helps, David. emboss-bounces at lists.open-bio.org schrieb am 14/12/2010 19:33:36: > Hello, > > I am having some trouble getting vectorstrip to match the vector > sequences with the sequence data. I have attached the vector file and some > of my test data along with this message. I don't know if it is a formatting > error or not but I am out of ideas for this one. However, I haven''t used > this software before so I may be missing something, but I listed the command > line arguments that I changed (those that are prompted but NOT listed below > were kept as the default settings). Please let me know if you have any > suggestions, thank you! > > Also, is there a way to trim quality files, too? > > > vectorstrip -sequence L3-cDNA-500-PFU-clA-M13R.ab1.seq -vectorsfile > pCR4TOPO.fasta > -Show only the best hits? N > <\CODE> > > -- > > Alan Twaddle, B.S. > MUC class of 2010 > [Anhang "L3-cDNA-500-PFU-clA-M13R.ab1.seq" gel?scht von David > Bauer/SGQRH/DE/BHC/BAYER] [Anhang "pCR4-TOPO.fasta" gel?scht von > David Bauer/SGQRH/DE/BHC/BAYER] > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss From nirvana.cmb at gmail.com Thu Dec 30 09:20:35 2010 From: nirvana.cmb at gmail.com (Yufei Yang) Date: Thu, 30 Dec 2010 17:20:35 +0800 Subject: [EMBOSS] question with Dan Message-ID: Hello everyone, I want to calculate the melting temperature (Tm) of RNA-DNA hybrid using EMBOSS dan. Dose the qualifier '-rna yes' means calculating RNA-DNA hybrid instead of RNA-RNA? Anybody can help me? Thank you very much for your time and attention. waiting for the response with warm regards -- Yufei Yang College of Life Sciences Beijing Normal University Beijing, 100875 P. R. China