From biopython at maubp.freeserve.co.uk  Wed Apr  7 05:36:24 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Wed, 7 Apr 2010 10:36:24 +0100
Subject: [EMBOSS] Nucleotide dotplots with EMBOSS
Message-ID: <x2m320fb6e01004070236tf088eabap79c1f2c56c5baf04@mail.gmail.com>

Hello EMBOSS team,

I've just been using dottup to produce dot plots comparing two
nucleotide sequences (two assemblies), where I have regions of very
high similarity but some inversions.
http://emboss.sourceforge.net/apps/release/6.2/emboss/apps/dottup.html

I've noticed that I can tell dotplot to reverse either of the
sequences, but I would actually like it to search both for forward
matches AND reverse matches to display on the same plot (ideally using
different colours). Is this possible already, or might it be a
reasonable feature request? Right now I can generate one plot with the
forward matches, and a second plot with the reverse matches - not
ideal.

Thanks,

Peter C.

P.S.
While I'm asking, I'd also like (colour) PDF output, since working
with PDF files is much easier on the Mac than postscript (which
thankfully is trivial to convert into PDF - so this isn't a big issue
for me).

From pmr at ebi.ac.uk  Wed Apr  7 07:01:06 2010
From: pmr at ebi.ac.uk (Peter Rice)
Date: Wed, 07 Apr 2010 12:01:06 +0100
Subject: [EMBOSS] Nucleotide dotplots with EMBOSS
In-Reply-To: <x2m320fb6e01004070236tf088eabap79c1f2c56c5baf04@mail.gmail.com>
References: <x2m320fb6e01004070236tf088eabap79c1f2c56c5baf04@mail.gmail.com>
Message-ID: <4BBC65F2.1080203@ebi.ac.uk>

On 07/04/2010 10:36, Peter Cock wrote:

> I've noticed that I can tell dotplot to reverse either of the
> sequences, but I would actually like it to search both for forward
> matches AND reverse matches to display on the same plot (ideally using
> different colours). Is this possible already, or might it be a
> reasonable feature request? Right now I can generate one plot with the
> forward matches, and a second plot with the reverse matches - not
> ideal.

Sounds like a reasonable request. We will look into it.

> While I'm asking, I'd also like (colour) PDF output, since working
> with PDF files is much easier on the Mac than postscript (which
> thankfully is trivial to convert into PDF - so this isn't a big issue
> for me).

Should be possible with plplot. We will look into adding PDF to the 
possible output devices.

regards,

Peter Rice

From biopython at maubp.freeserve.co.uk  Wed Apr  7 08:02:51 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Wed, 7 Apr 2010 13:02:51 +0100
Subject: [EMBOSS] Nucleotide dotplots with EMBOSS
In-Reply-To: <4BBC65F2.1080203@ebi.ac.uk>
References: <x2m320fb6e01004070236tf088eabap79c1f2c56c5baf04@mail.gmail.com>
	<4BBC65F2.1080203@ebi.ac.uk>
Message-ID: <w2r320fb6e01004070502j7d96ac22j6fa9d3c45edb21a5@mail.gmail.com>

On Wed, Apr 7, 2010 at 12:01 PM, Peter Rice <pmr at ebi.ac.uk> wrote:
> Sounds like a reasonable request. We will look into it.
> ...
> Should be possible with plplot. We will look into adding PDF to the possible
> output devices.

Great.

Thanks,

Peter

From koenvanderdrift at gmail.com  Thu Apr  8 20:08:43 2010
From: koenvanderdrift at gmail.com (Koen van der Drift)
Date: Thu, 8 Apr 2010 20:08:43 -0400
Subject: [EMBOSS] tfm cannot find doc files when building through fink (OS X)
Message-ID: <3C80F4C4-156F-430B-8858-5D9E52B62BB4@gmail.com>

Hi,

When building emboss through fink, tfm gets confused where the doc  
files are installed:

$ tfm -html water
Displays full documentation for an application
Died: No documentation found in /sw/src/fink.build/emboss-6.2.0-2/ 
EMBOSS-6.2.0/html/ for program 'water'.

So it looks in the build directory, not in the actual location: /sw/ 
share/EMBOSS/doc/programs/html

Is there a way to force tfm to look in /sw/share/EMBOSS/doc/programs/ 
html ?


Thanks,

- Koen.

From andrew.warry at bbsrc.ac.uk  Fri Apr  9 05:46:31 2010
From: andrew.warry at bbsrc.ac.uk (andrew warry (BITS))
Date: Fri, 9 Apr 2010 10:46:31 +0100
Subject: [EMBOSS] tfm cannot find doc files when building through fink
 (OS X)
In-Reply-To: <3C80F4C4-156F-430B-8858-5D9E52B62BB4@gmail.com>
References: <3C80F4C4-156F-430B-8858-5D9E52B62BB4@gmail.com>
Message-ID: <C57CE776344DFE4A8B8E254640024EE50BB5ABFBC0@bitsexch1.bits.bbsrc.ac.uk>

Hi,
The same problem with tfm -html occurs on Redhat ES5 and Ubuntu 9.10 - I just noticed, because this broke the help implementation when I updated my local Emboss-Explorer installations.

Andrew



-----Original Message-----
From: emboss-bounces at lists.open-bio.org [mailto:emboss-bounces at lists.open-bio.org] On Behalf Of Koen van der Drift
Sent: 09 April 2010 01:09
To: emboss at emboss.open-bio.org
Subject: [EMBOSS] tfm cannot find doc files when building through fink (OS X)

Hi,

When building emboss through fink, tfm gets confused where the doc  
files are installed:

$ tfm -html water
Displays full documentation for an application
Died: No documentation found in /sw/src/fink.build/emboss-6.2.0-2/ 
EMBOSS-6.2.0/html/ for program 'water'.

So it looks in the build directory, not in the actual location: /sw/ 
share/EMBOSS/doc/programs/html

Is there a way to force tfm to look in /sw/share/EMBOSS/doc/programs/ 
html ?


Thanks,

- Koen.
_______________________________________________
EMBOSS mailing list
EMBOSS at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/emboss

-- 
Disclaimer: This e-mail and any attachments are confidential and intended solely for the use of the recipient(s) to whom they are addressed. If you have received it in error, please destroy all copies and inform the sender. This email and any attachments are believed to be free from viruses but BBSRC accepts no liability in connection therewith. 



From frech.christian at gmail.com  Sat Apr 10 19:19:30 2010
From: frech.christian at gmail.com (Christian Frech)
Date: Sat, 10 Apr 2010 16:19:30 -0700
Subject: [EMBOSS] Increasing resolution of EMBOSS output images?
In-Reply-To: <h2te8aaa07a1004101434p2b559e30r52148eae16846a51@mail.gmail.com>
References: <h2te8aaa07a1004101434p2b559e30r52148eae16846a51@mail.gmail.com>
Message-ID: <4BC10782.6020409@googlemail.com>

Hi all,

I am using polyplot and dottup from the EMBOSS package to produce dot 
plots. It works fine, but the resolution of the output images (PNG 
files) is too low to examine matches in detail. Is there a way to 
increase the resolution of output images?

Christian

From biopython at maubp.freeserve.co.uk  Tue Apr 13 07:43:08 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Tue, 13 Apr 2010 12:43:08 +0100
Subject: [EMBOSS] EMBOSS eprimer3 and latest primer3_core
Message-ID: <r2m320fb6e01004130443uaa5da081w79b25edb80a97b6a@mail.gmail.com>

Hello EMBOSS team,

I'm using EMBOSS 6.2.0 on Mac OS X 10.6.3 Snow Leopard:

$ embossversion
Reports the current EMBOSS version number
6.2.0

I need to design some primers so I wanted to try the EMBOSS tool
eprimer3, which as your documentation clearly explains requires me to
install the 'primer3' program from the Whitehead Institute
(specifically the primer3_core tool).

I downloaded and compiled the latest version of primer3, version 2.2.2
beta (using the default, i.e. just "make", which seems to be fine -
the Snow Leopard specific Makefile failed). It seems that EMBOSS
eprimer3 does not like this:

$ export EMBOSS_PRIMER3_CORE="/Users/xxx/Downloads/Software/primer3-2.2.2-beta/src/primer3_core"
$ eprimer3 fasta::lupine.nu lupine.eprimer3
Picks PCR primers and hybridization oligos
Error: Missing SEQUENCE tag

Instead, I downloaded and compiled primer3 version 1.1.4 (using the
defaults, i.e. just "make", there is no Snow Leopard specific Makefile
included) and that seems to work:

$ export EMBOSS_PRIMER3_CORE="/Users/xxx/Downloads/Software/primer3-1.1.4/src/primer3_core"
$ eprimer3 fasta::lupine.nu lupine.eprimer3Picks PCR primers and
hybridization oligos
Picks PCR primers and hybridization oligos

The eprimer3 output looks sensible too.

My guess is that something in the recent primer3 alpha and beta
releases of 2.x.x has changed since version 1.x.x and that EMBOSS
needs to be updated to cope. Is this a known issue?

Thanks,

Peter C.

From biopython at maubp.freeserve.co.uk  Tue Apr 13 08:44:28 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Tue, 13 Apr 2010 13:44:28 +0100
Subject: [EMBOSS] EMBOSS eprimer3 and ambiguous DNA
Message-ID: <u2o320fb6e01004130544x35d7c80ao16bf82f60bdcdb67@mail.gmail.com>

Hello again,

I just ran eprimer3 on a multiple FASTA file (using published genome
sequences), and noticed a couple of messages:

"Error: Unrecognized base in input sequence"

Additionally, for two of the sequences there were no primer pairs (just
some blank lines instead). These appear to correspond to two of the
sequences in my input which had IUPAC ambiguous characters in the
sequence (e.g. R, W, Y, N). The eprimer3 documentation does say
explicitly that for some input files such characters are converted into
N (options -mispriminglibraryfile and -mishyblibraryfile) .

What is supposed to happen in a sequence in the main input file has
such characters?

I would expect to still get back a candidate set of primers (even if they
do not cover the regions with ambiguous letters).

As an experiment I added an N character to the end of an unambiguous
sequence, and eprimer3 seemed happy. So, as a work around I've simply
replaced all the ambiguous characters (like R, W and Y) with N, and it
seems to work. Maybe eprimer3 could do this for me, or at least have
this limitation mentioned in the documentation?

Thanks,

Peter C.

From kellert at ohsu.edu  Tue Apr 13 15:07:22 2010
From: kellert at ohsu.edu (Tom Keller)
Date: Tue, 13 Apr 2010 12:07:22 -0700
Subject: [EMBOSS] EMBOSS eprimer3 and latest primer3_core
In-Reply-To: <r2m320fb6e01004130443uaa5da081w79b25edb80a97b6a@mail.gmail.com>
References: <r2m320fb6e01004130443uaa5da081w79b25edb80a97b6a@mail.gmail.com>
Message-ID: <95EED66E-037B-4E79-9B87-56DBA28578A1@ohsu.edu>

Hi,
I've just installed the beta version of primer3-2.2.2 also. The boulder_io format has been changed. For example, instead of 
SEQUENCE=ACGT....
the new tag is
SEQUENCE_TEMPLATE=ACGT...
also, notice the underscores (they are hard to see in the html manual, cause of the link markup)

I tested primer3_core. It works with this example:
SEQUENCE_ID=PT203_A02
SEQUENCE_TEMPLATE=GTGCCGTGCTCGGCTTCTCTGGTCACAGTCTTTTGTCTCTAGGGCTAAGACAGTGCCTGTCCCTGAAAAGTGGACCACTCCTCAAGAGATAAAACAAAAGATCCAACTCCTCCACCAGAAGTCAGAGTTTGTGGAGAAGAGCACAAAGTACTTCTCAGGTAGATGGGCTTGGGAGAAGATTGGAGGTGCATGCTCACTTCCTCCCTAAGATCCACATAGCCCAGAGCCCCTCACTTCCCTCCTCTTCCCCTGGTCTTGCTGACCTGCCTTCAACCTCTCCTCCATCTGTCCCTGGCTGAGGGACCTAACTCCAGCTTCTCTCTGCTCCCTTTCCCACATTTTAGAAACCCTGCGTTCAGAAATGGAAATGTTCAATGGTGAGTCCAGCGGTAATGGTGTGTGCTGGCCTGGGGTTGTTGCAGTGTTCCCTTGTGCTGTTGACTTGAGGGGCCCTATTTAGAAGACAAAAAAAAAACCAAACACCTGGGGGCAAAAGTAAAA
SEQUENCE_TARGET=395,12
PRIMER_TASK=pick_detection_primers
PRIMER_PICK_LEFT=1
PRIMER_PICK_INTERNAL=1
PRIMER_PICK_RIGHT=1
PRIMER_OPT_SIZE=20
PRIMER_MIN_SIZE=17
PRIMER_MAX_SIZE=23
PRIMER_MAX_NS_ACCEPTED=1
PRIMER_PRODUCT_SIZE_RANGE=75-300
P3_FILE_FLAG=1
PRIMER_EXPLAIN_FLAG=1
=

But eprimer3 dies:
Error: Unable to read sequence './boulderio_template.txt'
Died: eprimer3 terminated: Bad value for '-sequence' and no prompt

Is it that the new format has not yet been accommodated?


thanks,
Tom

Thomas (Tom) Keller, PhD
kellert at ohsu.edu
503.494.2442
6339b R Jones Hall (BSc/CROET)
www.ohsu.edu/xd/research/research-cores/dna-analysis/

On Apr 13, 2010, at 4:43 AM, Peter wrote:

> Hello EMBOSS team,
> 
> I'm using EMBOSS 6.2.0 on Mac OS X 10.6.3 Snow Leopard:
> 
> $ embossversion
> Reports the current EMBOSS version number
> 6.2.0
> 
> I need to design some primers so I wanted to try the EMBOSS tool
> eprimer3, which as your documentation clearly explains requires me to
> install the 'primer3' program from the Whitehead Institute
> (specifically the primer3_core tool).
> 
> I downloaded and compiled the latest version of primer3, version 2.2.2
> beta (using the default, i.e. just "make", which seems to be fine -
> the Snow Leopard specific Makefile failed). It seems that EMBOSS
> eprimer3 does not like this:
> 
> $ export EMBOSS_PRIMER3_CORE="/Users/xxx/Downloads/Software/primer3-2.2.2-beta/src/primer3_core"
> $ eprimer3 fasta::lupine.nu lupine.eprimer3
> Picks PCR primers and hybridization oligos
> Error: Missing SEQUENCE tag
> 
> Instead, I downloaded and compiled primer3 version 1.1.4 (using the
> defaults, i.e. just "make", there is no Snow Leopard specific Makefile
> included) and that seems to work:
> 
> $ export EMBOSS_PRIMER3_CORE="/Users/xxx/Downloads/Software/primer3-1.1.4/src/primer3_core"
> $ eprimer3 fasta::lupine.nu lupine.eprimer3Picks PCR primers and
> hybridization oligos
> Picks PCR primers and hybridization oligos
> 
> The eprimer3 output looks sensible too.
> 
> My guess is that something in the recent primer3 alpha and beta
> releases of 2.x.x has changed since version 1.x.x and that EMBOSS
> needs to be updated to cope. Is this a known issue?
> 
> Thanks,
> 
> Peter C.
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss



From ajb at ebi.ac.uk  Tue Apr 13 16:15:42 2010
From: ajb at ebi.ac.uk (ajb at ebi.ac.uk)
Date: Tue, 13 Apr 2010 21:15:42 +0100 (BST)
Subject: [EMBOSS] EMBOSS eprimer3 and latest primer3_core
In-Reply-To: <95EED66E-037B-4E79-9B87-56DBA28578A1@ohsu.edu>
References: <r2m320fb6e01004130443uaa5da081w79b25edb80a97b6a@mail.gmail.com>
	<95EED66E-037B-4E79-9B87-56DBA28578A1@ohsu.edu>
Message-ID: <40862.86.26.12.63.1271189742.squirrel@webmail.ebi.ac.uk>

Hi,

A conversion was done on eprimer3.c earlier today to
use the new tag names. That was the easy bit. The hard bit
is deciding on names for the new and old version (we
intend having two versions for now and retiring the current, stable,
version at some stage).

Alan


> Hi,
> I've just installed the beta version of primer3-2.2.2 also. The boulder_io
> format has been changed. For example, instead of
> SEQUENCE=ACGT....
> the new tag is
> SEQUENCE_TEMPLATE=ACGT...
> also, notice the underscores (they are hard to see in the html manual,
> cause of the link markup)
>
> I tested primer3_core. It works with this example:
> SEQUENCE_ID=PT203_A02
> SEQUENCE_TEMPLATE=GTGCCGTGCTCGGCTTCTCTGGTCACAGTCTTTTGTCTCTAGGGCTAAGACAGTGCCTGTCCCTGAAAAGTGGACCACTCCTCAAGAGATAAAACAAAAGATCCAACTCCTCCACCAGAAGTCAGAGTTTGTGGAGAAGAGCACAAAGTACTTCTCAGGTAGATGGGCTTGGGAGAAGATTGGAGGTGCATGCTCACTTCCTCCCTAAGATCCACATAGCCCAGAGCCCCTCACTTCCCTCCTCTTCCCCTGGTCTTGCTGACCTGCCTTCAACCTCTCCTCCATCTGTCCCTGGCTGAGGGACCTAACTCCAGCTTCTCTCTGCTCCCTTTCCCACATTTTAGAAACCCTGCGTTCAGAAATGGAAATGTTCAATGGTGAGTCCAGCGGTAATGGTGTGTGCTGGCCTGGGGTTGTTGCAGTGTTCCCTTGTGCTGTTGACTTGAGGGGCCCTATTTAGAAGACAAAAAAAAAACCAAACACCTGGGGGCAAAAGTAAAA
> SEQUENCE_TARGET=395,12
> PRIMER_TASK=pick_detection_primers
> PRIMER_PICK_LEFT=1
> PRIMER_PICK_INTERNAL=1
> PRIMER_PICK_RIGHT=1
> PRIMER_OPT_SIZE=20
> PRIMER_MIN_SIZE=17
> PRIMER_MAX_SIZE=23
> PRIMER_MAX_NS_ACCEPTED=1
> PRIMER_PRODUCT_SIZE_RANGE=75-300
> P3_FILE_FLAG=1
> PRIMER_EXPLAIN_FLAG=1
> =
>
> But eprimer3 dies:
> Error: Unable to read sequence './boulderio_template.txt'
> Died: eprimer3 terminated: Bad value for '-sequence' and no prompt
>
> Is it that the new format has not yet been accommodated?
>
>
> thanks,
> Tom
>
> Thomas (Tom) Keller, PhD
> kellert at ohsu.edu
> 503.494.2442
> 6339b R Jones Hall (BSc/CROET)
> www.ohsu.edu/xd/research/research-cores/dna-analysis/
>
> On Apr 13, 2010, at 4:43 AM, Peter wrote:
>
>> Hello EMBOSS team,
>>
>> I'm using EMBOSS 6.2.0 on Mac OS X 10.6.3 Snow Leopard:
>>
>> $ embossversion
>> Reports the current EMBOSS version number
>> 6.2.0
>>
>> I need to design some primers so I wanted to try the EMBOSS tool
>> eprimer3, which as your documentation clearly explains requires me to
>> install the 'primer3' program from the Whitehead Institute
>> (specifically the primer3_core tool).
>>
>> I downloaded and compiled the latest version of primer3, version 2.2.2
>> beta (using the default, i.e. just "make", which seems to be fine -
>> the Snow Leopard specific Makefile failed). It seems that EMBOSS
>> eprimer3 does not like this:
>>
>> $ export
>> EMBOSS_PRIMER3_CORE="/Users/xxx/Downloads/Software/primer3-2.2.2-beta/src/primer3_core"
>> $ eprimer3 fasta::lupine.nu lupine.eprimer3
>> Picks PCR primers and hybridization oligos
>> Error: Missing SEQUENCE tag
>>
>> Instead, I downloaded and compiled primer3 version 1.1.4 (using the
>> defaults, i.e. just "make", there is no Snow Leopard specific Makefile
>> included) and that seems to work:
>>
>> $ export
>> EMBOSS_PRIMER3_CORE="/Users/xxx/Downloads/Software/primer3-1.1.4/src/primer3_core"
>> $ eprimer3 fasta::lupine.nu lupine.eprimer3Picks PCR primers and
>> hybridization oligos
>> Picks PCR primers and hybridization oligos
>>
>> The eprimer3 output looks sensible too.
>>
>> My guess is that something in the recent primer3 alpha and beta
>> releases of 2.x.x has changed since version 1.x.x and that EMBOSS
>> needs to be updated to cope. Is this a known issue?
>>
>> Thanks,
>>
>> Peter C.
>> _______________________________________________
>> EMBOSS mailing list
>> EMBOSS at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/emboss
>
>
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss
>



From pmr at ebi.ac.uk  Wed Apr 14 05:45:15 2010
From: pmr at ebi.ac.uk (Peter Rice)
Date: Wed, 14 Apr 2010 10:45:15 +0100
Subject: [EMBOSS] Why always Guide protein sequence xxx not found in
 nucleic sequence xxx??
In-Reply-To: <OF52A42504.A98A6162-ON86257705.00147981-86257705.001508C0@unomaha.edu>
References: <OF52A42504.A98A6162-ON86257705.00147981-86257705.001508C0@unomaha.edu>
Message-ID: <4BC58EAB.9060803@ebi.ac.uk>

On 14/04/2010 04:49, Jianpeng Xu wrote:
> Hi,
>
> I am a researcher in US.
>
> I'm trying to use tranalign to align DNA sequences but it
> keeps throwing errors.  I tested it on the example input files from
> the documentation web pages and those work fine.
>
> Error: Guide protein sequence SS1G01814 not found in nucleic sequence
> SS1G01814
>
> it throws the same error for every pair of proteins in the file.
>
> May you tell me the reason?

"Pair of proteins" sounds odd ... the first set of sequences are the 
nucleotide coding sequences. The second set of sequences are the protein 
translations.

If you send some example sequneces to emboss-bug at emboss.open-bio.org we 
can take a look and tell you excatly why you get the message.

regards,

Peter Rice

From korndoerfer at crelux.com  Fri Apr 16 05:18:11 2010
From: korndoerfer at crelux.com (Ingo P. Korndoerfer)
Date: Fri, 16 Apr 2010 11:18:11 +0200
Subject: [EMBOSS] showalign: maintain numbering of the reference sequence
Message-ID: <4BC82B53.2060504@crelux.com>

dear fellow emboss users,

who can help me out with this one:

we URGENTLY need some commandline driven program, that nicely displays
emma output, BUT MAINTAINS the sequence numbering of the reference sequence.

showalign seems to simply start counting at the first residue, even if
it is a construct with just a purification tag, and happily includes
alignment gaps in the numbering.

this makes it real difficult for us to find a certain residue of a
protein in our alignment, particularly important if the whole team wants
to discuss certain details ...

i have tried the refseq keyword, but that did not seem to do that ...

any ideas, i'd be happy. would be nice if it were in emboss, since that
is installed on all machines already, but if need to, we can install
additional software ...

greetings

ingo

-------------- next part --------------
A non-text attachment was scrubbed...
Name: korndoerfer.vcf
Type: text/x-vcard
Size: 318 bytes
Desc: not available
URL: <http://lists.open-bio.org/pipermail/emboss/attachments/20100416/faf7d38e/attachment.vcf>

From pmr at ebi.ac.uk  Fri Apr 16 06:35:29 2010
From: pmr at ebi.ac.uk (Peter Rice)
Date: Fri, 16 Apr 2010 11:35:29 +0100
Subject: [EMBOSS] showalign: maintain numbering of the reference sequence
In-Reply-To: <4BC82B53.2060504@crelux.com>
References: <4BC82B53.2060504@crelux.com>
Message-ID: <4BC83D71.4060905@ebi.ac.uk>

Dear Ingo,

On 16/04/2010 10:18, Ingo P. Korndoerfer wrote:
> dear fellow emboss users,
>
> who can help me out with this one:
>
> we URGENTLY need some commandline driven program, that nicely displays
> emma output, BUT MAINTAINS the sequence numbering of the reference sequence.

Interesting. Emma output is just a multiply aligned sequence file in any 
format.

> showalign seems to simply start counting at the first residue, even if
> it is a construct with just a purification tag, and happily includes
> alignment gaps in the numbering.

Showalign is the obvious application to update.

> this makes it real difficult for us to find a certain residue of a
> protein in our alignment, particularly important if the whole team wants
> to discuss certain details ...
>
> i have tried the refseq keyword, but that did not seem to do that ...

We can change that. Refseq is used to make one sequence appear first and be 
used to control numbering too. The ouptut of showalign is a text file (it 
does not write out an align object) so we are free to modify it.

The easiest is to add an option to number by the reference sequence when 
the ruler appears.

We can also add a test for a sequence ID matching without being case 
sensitive to make the -refseq option easier to use.

> any ideas, i'd be happy. would be nice if it were in emboss, since that
> is installed on all machines already, but if need to, we can install
> additional software ...

Happy to help. If you can give some examples of what you would like we can 
send you a version to test and then add it to the July release.

regards,

Peter Rice

From Kevin.Clancy at lifetech.com  Fri Apr 16 15:01:22 2010
From: Kevin.Clancy at lifetech.com (Clancy, Kevin)
Date: Fri, 16 Apr 2010 12:01:22 -0700
Subject: [EMBOSS] File standards for reporting analysis tool results
Message-ID: <211C19306C13A84B9A2712D3D22F5201D5AEC1051E@CBD01MAIL02.ads.invitrogen.net>

Folks
I'm trying to identify if there are any well supported file formats that folk use for reporting results from analysis tools. So MSA or Nexus formats have been devised for multiple alignments and phylogenetics analyses. The work being done on SAM/BAM files standardizes reporting mapped next gen data, eg with CIGAR strings. There has been some use of GFF and BAM files for reporting parts of an analysis. I was wondering if there was a generalized format used by EMBOSS tools to standardize their outputs? Has anyone used BSML or other file formats standards in this fashion?

Thanks for your feedback.
kevin

Kevin Clancy, PhD
Invitrogen: Life tech
Carlsbad, CA 92008




From jison at ebi.ac.uk  Thu Apr 22 10:52:47 2010
From: jison at ebi.ac.uk (Jon Ison)
Date: Thu, 22 Apr 2010 15:52:47 +0100 (BST)
Subject: [EMBOSS] Workshop for Web Service Providers
Message-ID: <60512.172.22.100.208.1271947967.squirrel@webmail.ebi.ac.uk>

Dear embossnians

The workshop below will introduce comprehensive guidelines for design, semantic annotation and
publishing of SOAP-based Web Services in the area of life sciences.

http://www.cbs.dtu.dk/courses/embrace/2010-06-02/

Please take a look

Cheers

Jon


From biopython at maubp.freeserve.co.uk  Thu Apr 22 11:06:27 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Thu, 22 Apr 2010 16:06:27 +0100
Subject: [EMBOSS] ABI to FASTQ with seqret
In-Reply-To: <320fb6e01003300656g6d9b5c28oe0f98f8deedbd484@mail.gmail.com>
References: <320fb6e01003300446g487fb954jdc94112224182772@mail.gmail.com>
	<4BB1F8F8.8050608@ebi.ac.uk> <4BB1FBE1.8030400@ebi.ac.uk>
	<320fb6e01003300656g6d9b5c28oe0f98f8deedbd484@mail.gmail.com>
Message-ID: <i2i320fb6e01004220806m34bb1c66re9ae85df406c5f2a@mail.gmail.com>

On Tue, Mar 30, 2010 at 2:56 PM, Peter <biopython at maubp.freeserve.co.uk> wrote:
> On Tue, Mar 30, 2010 at 2:25 PM, Peter Rice <pmr at ebi.ac.uk> wrote:
>>
>> On 30/03/2010 14:13, Peter Rice wrote:
>>
>>> Where do I look to find scores that we can use (and how do we convert
>>> those to phred quality scores)?
>>
>> Aha, found something. The field is called PCON (confidence values), with
>> values 0-255.
>>
>> There is a possibility that these could be phred scores, but I suspect they
>> are whatever the basecaller has decided to write there.
>>
>> http://www.appliedbiosystems.com/support/software_community/ABIF_File_Format.pdf
>>
>> Peter R.
>
> Hmm. Good question - I don't know, although if they are PHRED scores
> they could go unusually high (we'd expect say 0 to 50 for a raw read).
> It could be some other encoding (e.g. scaled from 0 for a poor base to
> 255 for a perfect base). Do you have any contacts at Applied Biosystems
> to ask?
>
> Peter C.
>

Hello again Peter R (& everyone else at EMBOSS),

Did you manage to find out if the PCON confidence values in ABI files
are PHRED quality scores or not?

Regards,

Peter C.

From pmr at ebi.ac.uk  Thu Apr 22 11:22:01 2010
From: pmr at ebi.ac.uk (Peter Rice)
Date: Thu, 22 Apr 2010 16:22:01 +0100
Subject: [EMBOSS] ABI to FASTQ with seqret
In-Reply-To: <i2i320fb6e01004220806m34bb1c66re9ae85df406c5f2a@mail.gmail.com>
References: <320fb6e01003300446g487fb954jdc94112224182772@mail.gmail.com>	
	<4BB1F8F8.8050608@ebi.ac.uk> <4BB1FBE1.8030400@ebi.ac.uk>	
	<320fb6e01003300656g6d9b5c28oe0f98f8deedbd484@mail.gmail.com>
	<i2i320fb6e01004220806m34bb1c66re9ae85df406c5f2a@mail.gmail.com>
Message-ID: <4BD06999.2080502@ebi.ac.uk>

On 22/04/2010 16:06, Peter C. wrote:

> Hello again Peter R (&  everyone else at EMBOSS),
>
> Did you manage to find out if the PCON confidence values in ABI files
> are PHRED quality scores or not?

Yes ... and maybe.

The first scores are written bu the ABI basecaller.

A second set can be written by any basecaller. These may be phred quality 
scores but could in theory be anything.

EMBOSS will assume they are phred scores as there is no way to tell otherwise.

regards,

Peter Rice

From biopython at maubp.freeserve.co.uk  Thu Apr 22 11:48:29 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Thu, 22 Apr 2010 16:48:29 +0100
Subject: [EMBOSS] ABI to FASTQ with seqret
In-Reply-To: <4BD06999.2080502@ebi.ac.uk>
References: <320fb6e01003300446g487fb954jdc94112224182772@mail.gmail.com>
	<4BB1F8F8.8050608@ebi.ac.uk> <4BB1FBE1.8030400@ebi.ac.uk>
	<320fb6e01003300656g6d9b5c28oe0f98f8deedbd484@mail.gmail.com>
	<i2i320fb6e01004220806m34bb1c66re9ae85df406c5f2a@mail.gmail.com>
	<4BD06999.2080502@ebi.ac.uk>
Message-ID: <x2q320fb6e01004220848p386a567eg2a76d38689f8571f@mail.gmail.com>

On Thu, Apr 22, 2010 at 4:22 PM, Peter Rice <pmr at ebi.ac.uk> wrote:
>
> On 22/04/2010 16:06, Peter C. wrote:
>
>> Hello again Peter R (& ?everyone else at EMBOSS),
>>
>> Did you manage to find out if the PCON confidence values in ABI files
>> are PHRED quality scores or not?
>
> Yes ... and maybe.
>
> The first scores are written bu the ABI basecaller.
>
> A second set can be written by any basecaller. These may be phred quality
> scores but could in theory be anything.
>
> EMBOSS will assume they are phred scores as there is no way to tell
> otherwise.
>
> regards,
>
> Peter Rice

Does this mean there is an updated seqret in a public repository where I
can convert an ABI file to FASTQ taking the ABI basecaller's sequence
and PHRED scores? I'd be interested to test that... or a patch against
EMBOSS 6.2.0.

Thanks,

Peter C.


From pmr at ebi.ac.uk  Thu Apr 22 13:01:42 2010
From: pmr at ebi.ac.uk (Peter Rice)
Date: Thu, 22 Apr 2010 18:01:42 +0100
Subject: [EMBOSS] ABI to FASTQ with seqret
In-Reply-To: <x2q320fb6e01004220848p386a567eg2a76d38689f8571f@mail.gmail.com>
References: <320fb6e01003300446g487fb954jdc94112224182772@mail.gmail.com>	
	<4BB1F8F8.8050608@ebi.ac.uk> <4BB1FBE1.8030400@ebi.ac.uk>	
	<320fb6e01003300656g6d9b5c28oe0f98f8deedbd484@mail.gmail.com>	
	<i2i320fb6e01004220806m34bb1c66re9ae85df406c5f2a@mail.gmail.com>	
	<4BD06999.2080502@ebi.ac.uk>
	<x2q320fb6e01004220848p386a567eg2a76d38689f8571f@mail.gmail.com>
Message-ID: <4BD080F6.3060409@ebi.ac.uk>

On 22/04/2010 16:48, Peter Cock wrote:

> Does this mean there is an updated seqret in a public repository where I
> can convert an ABI file to FASTQ taking the ABI basecaller's sequence
> and PHRED scores? I'd be interested to test that... or a patch against
> EMBOSS 6.2.0.

It is in the latest CVS code and will appeart in the July release.

regards,

Peter Rice

From koenvanderdrift at gmail.com  Thu Apr 22 19:03:05 2010
From: koenvanderdrift at gmail.com (Koen van der Drift)
Date: Thu, 22 Apr 2010 19:03:05 -0400
Subject: [EMBOSS] accessing emboss ftp site
Message-ID: <6F57C2D1-8927-420C-940C-C6EC0C62AABE@gmail.com>

Hi,

For a while now I am unable to access the emboss ftp site using the OS  
X client Transmit. Loggin in works fine, but it chokes on the LIST  
command. I have no problems accessing it from the command line. I have  
added the output from Transmit below. I don't know if this is a  
Transmit or emboss issue, but just wanted to let you know.

Thanks,

- Koen.


Transmit 3.6.9 Session Transcript
LibNcFTP 3.2.1 (August 13, 2007) compiled for UNIX
Uname: Darwin|exile.local|9.8.0|Darwin Kernel Version 9.8.0: Wed Jul  
15 16:57:01 PDT 2009; root:xnu-1228.15.4~1/RELEASE_PPC|Power Macintosh
220: (vsFTPd 2.0.1)
Connected to emboss.open-bio.org.
Cmd: USER anonymous
331: Please specify the password.
Cmd: PASS NcFTP@
230: Login successful.
Cmd: TYPE A
200: Switching to ASCII mode.
Logged in to emboss.open-bio.org as anonymous.
Cmd: SYST
215: UNIX Type: L8
Cmd: PWD
257: "/"
Cmd: CWD /pub/EMBOSS/fixes
250: Directory successfully changed.
Cmd: PWD
257: "/pub/EMBOSS/fixes"
Cmd: PASV
227: Entering Passive Mode (208,94,50,58,83,232)
Cmd: LIST -a
Could not read reply from control connection -- timed out. (SReadline 1)
220: (vsFTPd 2.0.1)
Connected to emboss.open-bio.org.
Cmd: USER anonymous
331: Please specify the password.
Cmd: PASS NcFTP@
230: Login successful.
Logged in to emboss.open-bio.org as anonymous.
Cmd: SYST
215: UNIX Type: L8
Cmd: PWD
257: "/"
Cmd: CWD /pub/EMBOSS/fixes
250: Directory successfully changed.
Cmd: PWD
257: "/pub/EMBOSS/fixes"
Cmd: PASV
227: Entering Passive Mode (208,94,50,58,222,100)
Cmd: LIST -a
Could not read reply from control connection -- timed out. (SReadline 1)


From dag at sonsorol.org  Thu Apr 22 19:28:27 2010
From: dag at sonsorol.org (Chris Dagdigian)
Date: Thu, 22 Apr 2010 19:28:27 -0400
Subject: [EMBOSS] accessing emboss ftp site
In-Reply-To: <6F57C2D1-8927-420C-940C-C6EC0C62AABE@gmail.com>
References: <6F57C2D1-8927-420C-940C-C6EC0C62AABE@gmail.com>
Message-ID: <4BD0DB9B.5050005@sonsorol.org>


Might be an issue with the Juniper Netscreen firewall/IDS security 
appliance that sits upstream of the EMBOSS FTP server. I'll take a look 
at the security logs and alerts.

-Chris


Koen van der Drift wrote:
> Hi,
>
> For a while now I am unable to access the emboss ftp site using the OS X
> client Transmit. Loggin in works fine, but it chokes on the LIST
> command. I have no problems accessing it from the command line. I have
> added the output from Transmit below. I don't know if this is a Transmit
> or emboss issue, but just wanted to let you know.
>
> Thanks,
>
> - Koen.
>
>
> Transmit 3.6.9 Session Transcript
> LibNcFTP 3.2.1 (August 13, 2007) compiled for UNIX
> Uname: Darwin|exile.local|9.8.0|Darwin Kernel Version 9.8.0: Wed Jul 15
> 16:57:01 PDT 2009; root:xnu-1228.15.4~1/RELEASE_PPC|Power Macintosh
> 220: (vsFTPd 2.0.1)
> Connected to emboss.open-bio.org.
> Cmd: USER anonymous
> 331: Please specify the password.
> Cmd: PASS NcFTP@
> 230: Login successful.
> Cmd: TYPE A
> 200: Switching to ASCII mode.
> Logged in to emboss.open-bio.org as anonymous.
> Cmd: SYST
> 215: UNIX Type: L8
> Cmd: PWD
> 257: "/"
> Cmd: CWD /pub/EMBOSS/fixes
> 250: Directory successfully changed.
> Cmd: PWD
> 257: "/pub/EMBOSS/fixes"
> Cmd: PASV
> 227: Entering Passive Mode (208,94,50,58,83,232)
> Cmd: LIST -a
> Could not read reply from control connection -- timed out. (SReadline 1)
> 220: (vsFTPd 2.0.1)
> Connected to emboss.open-bio.org.
> Cmd: USER anonymous
> 331: Please specify the password.
> Cmd: PASS NcFTP@
> 230: Login successful.
> Logged in to emboss.open-bio.org as anonymous.
> Cmd: SYST
> 215: UNIX Type: L8
> Cmd: PWD
> 257: "/"
> Cmd: CWD /pub/EMBOSS/fixes
> 250: Directory successfully changed.
> Cmd: PWD
> 257: "/pub/EMBOSS/fixes"
> Cmd: PASV
> 227: Entering Passive Mode (208,94,50,58,222,100)
> Cmd: LIST -a
> Could not read reply from control connection -- timed out. (SReadline 1)
>
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss

From koenvanderdrift at gmail.com  Fri Apr 23 10:56:45 2010
From: koenvanderdrift at gmail.com (Koen van der Drift)
Date: Fri, 23 Apr 2010 10:56:45 -0400
Subject: [EMBOSS] accessing emboss ftp site
In-Reply-To: <4BD0DB9B.5050005@sonsorol.org>
References: <6F57C2D1-8927-420C-940C-C6EC0C62AABE@gmail.com>
	<4BD0DB9B.5050005@sonsorol.org>
Message-ID: <l2o5cba6b9f1004230756gf04316acq8519b375ce29e0d8@mail.gmail.com>

Just for the record, it used to work with Transmit, this is only from
the last few months.

- Koen.

On Thu, Apr 22, 2010 at 7:28 PM, Chris Dagdigian <dag at sonsorol.org> wrote:
>
> Might be an issue with the Juniper Netscreen firewall/IDS security appliance
> that sits upstream of the EMBOSS FTP server. I'll take a look at the
> security logs and alerts.
>
> -Chris
>
>
> Koen van der Drift wrote:
>>
>> Hi,
>>
>> For a while now I am unable to access the emboss ftp site using the OS X
>> client Transmit. Loggin in works fine, but it chokes on the LIST
>> command. I have no problems accessing it from the command line. I have
>> added the output from Transmit below. I don't know if this is a Transmit
>> or emboss issue, but just wanted to let you know.
>>
>> Thanks,
>>
>> - Koen.
>>
>>
>> Transmit 3.6.9 Session Transcript
>> LibNcFTP 3.2.1 (August 13, 2007) compiled for UNIX
>> Uname: Darwin|exile.local|9.8.0|Darwin Kernel Version 9.8.0: Wed Jul 15
>> 16:57:01 PDT 2009; root:xnu-1228.15.4~1/RELEASE_PPC|Power Macintosh
>> 220: (vsFTPd 2.0.1)
>> Connected to emboss.open-bio.org.
>> Cmd: USER anonymous
>> 331: Please specify the password.
>> Cmd: PASS NcFTP@
>> 230: Login successful.
>> Cmd: TYPE A
>> 200: Switching to ASCII mode.
>> Logged in to emboss.open-bio.org as anonymous.
>> Cmd: SYST
>> 215: UNIX Type: L8
>> Cmd: PWD
>> 257: "/"
>> Cmd: CWD /pub/EMBOSS/fixes
>> 250: Directory successfully changed.
>> Cmd: PWD
>> 257: "/pub/EMBOSS/fixes"
>> Cmd: PASV
>> 227: Entering Passive Mode (208,94,50,58,83,232)
>> Cmd: LIST -a
>> Could not read reply from control connection -- timed out. (SReadline 1)
>> 220: (vsFTPd 2.0.1)
>> Connected to emboss.open-bio.org.
>> Cmd: USER anonymous
>> 331: Please specify the password.
>> Cmd: PASS NcFTP@
>> 230: Login successful.
>> Logged in to emboss.open-bio.org as anonymous.
>> Cmd: SYST
>> 215: UNIX Type: L8
>> Cmd: PWD
>> 257: "/"
>> Cmd: CWD /pub/EMBOSS/fixes
>> 250: Directory successfully changed.
>> Cmd: PWD
>> 257: "/pub/EMBOSS/fixes"
>> Cmd: PASV
>> 227: Entering Passive Mode (208,94,50,58,222,100)
>> Cmd: LIST -a
>> Could not read reply from control connection -- timed out. (SReadline 1)
>>
>> _______________________________________________
>> EMBOSS mailing list
>> EMBOSS at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/emboss
>

From dag at sonsorol.org  Fri Apr 23 11:44:29 2010
From: dag at sonsorol.org (Chris Dagdigian)
Date: Fri, 23 Apr 2010 11:44:29 -0400
Subject: [EMBOSS] accessing emboss ftp site
In-Reply-To: <l2o5cba6b9f1004230756gf04316acq8519b375ce29e0d8@mail.gmail.com>
References: <6F57C2D1-8927-420C-940C-C6EC0C62AABE@gmail.com>	
	<4BD0DB9B.5050005@sonsorol.org>
	<l2o5cba6b9f1004230756gf04316acq8519b375ce29e0d8@mail.gmail.com>
Message-ID: <4BD1C05D.5010109@sonsorol.org>


In the last few months the open-bio.org servers switched datacenters, IP 
addresses and firewall/IDS appliances. Lots of juicy things to look at 
and debug.

Koen - if you have a chance can you send me the IP address that you are 
using to connect from? I might be able to find some relevant log entries 
with that info.

-Chris



Koen van der Drift wrote:
> Just for the record, it used to work with Transmit, this is only from
> the last few months.
>
> - Koen.
>
> On Thu, Apr 22, 2010 at 7:28 PM, Chris Dagdigian<dag at sonsorol.org>  wrote:
>> Might be an issue with the Juniper Netscreen firewall/IDS security appliance
>> that sits upstream of the EMBOSS FTP server. I'll take a look at the
>> security logs and alerts.
>>
>> -Chris
>>
>>
>> Koen van der Drift wrote:
>>> Hi,
>>>
>>> For a while now I am unable to access the emboss ftp site using the OS X
>>> client Transmit. Loggin in works fine, but it chokes on the LIST
>>> command. I have no problems accessing it from the command line. I have
>>> added the output from Transmit below. I don't know if this is a Transmit
>>> or emboss issue, but just wanted to let you know.
>>>
>>> Thanks,
>>>
>>> - Koen.
>>>
>>>
>>> Transmit 3.6.9 Session Transcript
>>> LibNcFTP 3.2.1 (August 13, 2007) compiled for UNIX
>>> Uname: Darwin|exile.local|9.8.0|Darwin Kernel Version 9.8.0: Wed Jul 15
>>> 16:57:01 PDT 2009; root:xnu-1228.15.4~1/RELEASE_PPC|Power Macintosh
>>> 220: (vsFTPd 2.0.1)
>>> Connected to emboss.open-bio.org.
>>> Cmd: USER anonymous
>>> 331: Please specify the password.
>>> Cmd: PASS NcFTP@
>>> 230: Login successful.
>>> Cmd: TYPE A
>>> 200: Switching to ASCII mode.
>>> Logged in to emboss.open-bio.org as anonymous.
>>> Cmd: SYST
>>> 215: UNIX Type: L8
>>> Cmd: PWD
>>> 257: "/"
>>> Cmd: CWD /pub/EMBOSS/fixes
>>> 250: Directory successfully changed.
>>> Cmd: PWD
>>> 257: "/pub/EMBOSS/fixes"
>>> Cmd: PASV
>>> 227: Entering Passive Mode (208,94,50,58,83,232)
>>> Cmd: LIST -a
>>> Could not read reply from control connection -- timed out. (SReadline 1)
>>> 220: (vsFTPd 2.0.1)
>>> Connected to emboss.open-bio.org.
>>> Cmd: USER anonymous
>>> 331: Please specify the password.
>>> Cmd: PASS NcFTP@
>>> 230: Login successful.
>>> Logged in to emboss.open-bio.org as anonymous.
>>> Cmd: SYST
>>> 215: UNIX Type: L8
>>> Cmd: PWD
>>> 257: "/"
>>> Cmd: CWD /pub/EMBOSS/fixes
>>> 250: Directory successfully changed.
>>> Cmd: PWD
>>> 257: "/pub/EMBOSS/fixes"
>>> Cmd: PASV
>>> 227: Entering Passive Mode (208,94,50,58,222,100)
>>> Cmd: LIST -a
>>> Could not read reply from control connection -- timed out. (SReadline 1)
>>>
>>> _______________________________________________
>>> EMBOSS mailing list
>>> EMBOSS at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/emboss

From asidhu at biomap.org  Mon Apr 26 01:35:13 2010
From: asidhu at biomap.org (Amandeep Sidhu)
Date: Mon, 26 Apr 2010 13:35:13 +0800
Subject: [EMBOSS] CFP: 23rd IEEE International Symposium on Computer-Based
	Medical Systems 2010
Message-ID: <CDBE908B-F041-41CE-B556-696E3C54B2BE@biomap.org>

IEEE CBMS 2010
23rd IEEE International Symposium on Computer-Based Medical Systems 2010
Perth, Australia, 12-15 October 2010

http://www.cbms2010.curtin.edu.au/

The 23rd IEEE International Symposium on Computer-Based Medical Systems (CBMS 2010) is intended to provide an international forum for discussing the latest results in the field of computational medicine. The scientific program of CBMS 2010 will consist of invited keynote talks given by leading scientists in the field, and regular and special track sessions that cover a broad array of issues which relate computing to medicine.

RELEVANT TOPICS

Network and Telemedicine Systems
Medical Databases & Information Systems
Computer-Aided Diagnosis
Medical Devices with Embedded Computers
Bioinformatics in Medicine
Software Systems in Medicine
Pervasive Health Systems and Services
Web-based Delivery of Medical Information
Medical Image Segmentation & Compression
Content Analysis of Biomedical Image Data
Knowledge-Based & Decision Support Systems
Hand-held Computing Applications in Medicine
Knowledge Discovery & Data Mining
Signal and Image Processing in Medicine
Multimedia Biomedical Databases

CBMS 2010 invites original previously unpublished contributions that are not submitted concurrently to a journal or another conference. Many of the above listed topics are represented by corresponding Special Tracks, while others are solely covered by the general CBMS track. Prospective authors are expected to submit their contributions to one of the corresponding Special Tracks or to the general track if none of the special tracks is relevant.

SPECIAL TRACKS

ST1: Computational Proteomics and Genomics
ST2: Knowledge Discovery and Decision Systems in Biomedicine
ST3: Ontologies for Biomedical Systems
ST4: HealthGrid & Cloud Computing
ST5: Technology Enhanced Learning in Medical Education
ST6: Intelligent Patient Management
ST7: Data Streams in Healthcare
ST8: Supporting Collaboration among Healthcare Workers
ST9: Telemedicine
ST10: Computer-Based Systems for Mental Health
ST11: Image Informatics in Biomedical Research and Clinical Medicine
ST12: e-Health

SUBMISSION GUIDELINES

Papers should be submitted electronically using EasyChair online submission system. The papers must be prepared following the IEEE two-column format and should not exceed the length of 6 (six) Letter-sized pages. LaTeX or Microsoft Word templates can be used when preparing the papers. Please, note that only PDF format of submissions is allowed.

Submission web site: http://www.easychair.org/conferences/?conf=cbms2010

All submissions will be peer-reviewed by at least three reviewers. The proceedings will be published by the IEEE Computer Society Press. At least one of the authors of accepted papers is required to register and present the work at the conference; otherwise their papers will be removed from the digital library after the conference.

IMPORTANT DATES

Submission deadline for regular papers:        		24 June 2010
Deadline for tutorial submission:                       24 June 2010
Notification of acceptation for papers and tutorials:    2 Aug 2010
Final camera ready due:                                  2 Sep 2010
Author registration:                                     2 Sep 2010

INTENDED AUDIENCE

Engineers, scientists, clinicians and managers involved in medical computing projects are encouraged to submit papers to the symposium and/or attend the symposium. The symposium provides its attendees with an opportunity to experience state-of-the-art research and development in a variety of topics directly and indirectly related to their own work. In addition to research papers, keynote speakers and tutorial sessions it provides participants with an opportunity to come up-to-date on important technological issues. The symposium encourages the participation of students engaged in research/development in computer-based medical systems.

Organizing Committee

GENERAL CHAIRS

Tharam Dillon, Curtin University of Technology, Australia
Daniel Rubin, National Center for Biomedical Ontologies, USA
William Gallagher, University College Dublin, Ireland

PROGRAM CHAIRS

Amandeep Sidhu, Curtin University of Technology, Australia
Alexey Tsymbal, Siemens, Germany

PUBLICATION CHAIRS

Mykola Pechenizkiy, Eindhoven University of Technology, Netherlands
Tony Hu, Drexel University, USA

SPECIAL TRACK CHAIRS

Maja Hadzic, Curtin University of Technology, Australia
Jake Chen, Indiana University, USA

TUTORIAL CHAIRS

Phoebe Chen, La Trobe University, Australia
Xiaofang Zhou, University of Queensland, Australia

PUBLICITY CHAIRS

Carolyn McGregor, University of Ontario Institute of Technology, Canada
Meifania Chen, Curtin University of Technology, Australia

From p.h.jones at liverpool.ac.uk  Mon Apr 26 08:47:44 2010
From: p.h.jones at liverpool.ac.uk (Philip H. Jones)
Date: Mon, 26 Apr 2010 13:47:44 +0100
Subject: [EMBOSS] Convert scf to fasta
Message-ID: <0D2BD44B-6881-48DA-BA12-8465A038A048@liverpool.ac.uk>

Hi

I have a large number of .scf files that I need to batch convert to  
fasta format. I thought that abiview would be able to perform this  
function but I cannot get abiview to read the .scf files (although  
various sources on the internet suggest that it should be able to do  
so). It reads and displays .ab1 files with no problems. The webpage  
describing input formats (http://emboss.sourceforge.net/docs/themes/SequenceFormats.html 
) doesn't mention scf. Is there an EMBOSS application that would  
convert .scf to .fa? Any help would be greatly appreciated. I am  
running Mac OSX 10.5.8 with EMBOSS 6.1.0-4 installed via fink.

Best wishes,

Phil Jones




From fernan.aguero at gmail.com  Mon Apr 26 09:29:10 2010
From: fernan.aguero at gmail.com (Fernan Aguero)
Date: Mon, 26 Apr 2010 10:29:10 -0300
Subject: [EMBOSS] Convert scf to fasta
In-Reply-To: <0D2BD44B-6881-48DA-BA12-8465A038A048@liverpool.ac.uk>
References: <0D2BD44B-6881-48DA-BA12-8465A038A048@liverpool.ac.uk>
Message-ID: <x2i520894aa1004260629xb09c8bccn2e2f10c1df3e7c7b@mail.gmail.com>

On Mon, Apr 26, 2010 at 9:47 AM, Philip H. Jones
<p.h.jones at liverpool.ac.uk> wrote:
> Hi
>
> I have a large number of .scf files that I need to batch convert to fasta
> format. I thought that abiview would be able to perform this function but I
> cannot get abiview to read the .scf files (although various sources on the
> internet suggest that it should be able to do so). It reads and displays
> .ab1 files with no problems. The webpage describing input formats
> (http://emboss.sourceforge.net/docs/themes/SequenceFormats.html) doesn't
> mention scf. Is there an EMBOSS application that would convert .scf to .fa?
> Any help would be greatly appreciated. I am running Mac OSX 10.5.8 with
> EMBOSS 6.1.0-4 installed via fink.
>
> Best wishes,
>
> Phil Jones

AFAIK, abiview reads trace files but it displays the trace and
sequence data _graphically_. That is to say it's not really meant to
be used for batch conversions.

For this you may want to try phred (free for academic use, see
www.phrap.org, runs on many Unix flavours) or any other basecaller
(don't use OS X myself, can't provide more info on this).

E.g. if you have all your scf files in a directory called 'chromats'
you would run phred like this:
phred -id chromats -sa my-sequences.fasta
to get a multiple fasta file named 'my-sequences.fasta' with the
corresponding sequences.

Note that you have many more options, as phred will also export/report
base quality values for your sequences.

Cheers,

-- 
fernan

From pmr at ebi.ac.uk  Mon Apr 26 10:10:44 2010
From: pmr at ebi.ac.uk (Peter Rice)
Date: Mon, 26 Apr 2010 15:10:44 +0100
Subject: [EMBOSS] Convert scf to fasta
In-Reply-To: <0D2BD44B-6881-48DA-BA12-8465A038A048@liverpool.ac.uk>
References: <0D2BD44B-6881-48DA-BA12-8465A038A048@liverpool.ac.uk>
Message-ID: <4BD59EE4.7030409@ebi.ac.uk>

Dear Phil,

On 26/04/2010 13:47, Philip H. Jones wrote:
> Hi
>
> I have a large number of .scf files that I need to batch convert to
> fasta format. I thought that abiview would be able to perform this
> function but I cannot get abiview to read the .scf files (although
> various sources on the internet suggest that it should be able to do
> so). It reads and displays .ab1 files with no problems. The webpage
> describing input formats
> (http://emboss.sourceforge.net/docs/themes/SequenceFormats.html) doesn't
> mention scf. Is there an EMBOSS application that would convert .scf to
> .fa? Any help would be greatly appreciated. I am running Mac OSX 10.5.8
> with EMBOSS 6.1.0-4 installed via fink.

We can read .abi files (we have some extensions for the next release to 
cover abi format in more detail).

I will pick up some scf files and check what the difference is. We have 
not tried them before.

Any other formats we can usefully cover?

regards,

Peter Rice

From gbottu at vub.ac.be  Mon Apr 26 11:28:46 2010
From: gbottu at vub.ac.be (Guy Bottu)
Date: Mon, 26 Apr 2010 17:28:46 +0200
Subject: [EMBOSS] Convert scf to fasta
In-Reply-To: <4BD59EE4.7030409@ebi.ac.uk>
References: <0D2BD44B-6881-48DA-BA12-8465A038A048@liverpool.ac.uk>
	<4BD59EE4.7030409@ebi.ac.uk>
Message-ID: <4BD5B12E.7010103@vub.ac.be>

Peter Rice wrote:
> Any other formats we can usefully cover?

The ZTR format (compressed version of SCF) designed by the Staden 
development team.

http://en.wikipedia.org/wiki/Staden_Package
http://www.be.embnet.org/stadenhelp/manual/formats_unix_toc.html

But how many people are still using it ? Maybe not worth the effort.

	Guy Bottu

From litd99 at gmail.com  Mon Apr 26 11:48:56 2010
From: litd99 at gmail.com (Tiandao Li)
Date: Mon, 26 Apr 2010 10:48:56 -0500
Subject: [EMBOSS] Convert scf to fasta
In-Reply-To: <x2i520894aa1004260629xb09c8bccn2e2f10c1df3e7c7b@mail.gmail.com>
References: <0D2BD44B-6881-48DA-BA12-8465A038A048@liverpool.ac.uk>
	<x2i520894aa1004260629xb09c8bccn2e2f10c1df3e7c7b@mail.gmail.com>
Message-ID: <v2l1ee6623e1004260848pbdd1e69eo30c7896327d2d946@mail.gmail.com>

Yes, definitely try phred/phrap/consed for base calling in batch mode, just
store all scf files in one folder, and google some help for it. the result
files include fasta files with quality scores, it is aonvient for downstream
analysis.

HTH.


http://www.phrap.org/phredphrapconsed.html


On Mon, Apr 26, 2010 at 8:29 AM, Fernan Aguero <fernan.aguero at gmail.com>wrote:

> On Mon, Apr 26, 2010 at 9:47 AM, Philip H. Jones
> <p.h.jones at liverpool.ac.uk> wrote:
> > Hi
> >
> > I have a large number of .scf files that I need to batch convert to fasta
> > format. I thought that abiview would be able to perform this function but
> I
> > cannot get abiview to read the .scf files (although various sources on
> the
> > internet suggest that it should be able to do so). It reads and displays
> > .ab1 files with no problems. The webpage describing input formats
> > (http://emboss.sourceforge.net/docs/themes/SequenceFormats.html) doesn't
> > mention scf. Is there an EMBOSS application that would convert .scf to
> .fa?
> > Any help would be greatly appreciated. I am running Mac OSX 10.5.8 with
> > EMBOSS 6.1.0-4 installed via fink.
> >
> > Best wishes,
> >
> > Phil Jones
>
> AFAIK, abiview reads trace files but it displays the trace and
> sequence data _graphically_. That is to say it's not really meant to
> be used for batch conversions.
>
> For this you may want to try phred (free for academic use, see
> www.phrap.org, runs on many Unix flavours) or any other basecaller
> (don't use OS X myself, can't provide more info on this).
>
> E.g. if you have all your scf files in a directory called 'chromats'
> you would run phred like this:
> phred -id chromats -sa my-sequences.fasta
> to get a multiple fasta file named 'my-sequences.fasta' with the
> corresponding sequences.
>
> Note that you have many more options, as phred will also export/report
> base quality values for your sequences.
>
> Cheers,
>
> --
> fernan
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss
>

From p.h.jones at liverpool.ac.uk  Mon Apr 26 12:03:37 2010
From: p.h.jones at liverpool.ac.uk (Philip H. Jones)
Date: Mon, 26 Apr 2010 17:03:37 +0100
Subject: [EMBOSS] Convert scf to fasta
In-Reply-To: <v2l1ee6623e1004260848pbdd1e69eo30c7896327d2d946@mail.gmail.com>
References: <0D2BD44B-6881-48DA-BA12-8465A038A048@liverpool.ac.uk>
	<x2i520894aa1004260629xb09c8bccn2e2f10c1df3e7c7b@mail.gmail.com>
	<v2l1ee6623e1004260848pbdd1e69eo30c7896327d2d946@mail.gmail.com>
Message-ID: <F6DC86C7-FC1B-4C48-A738-C7B2F0A3DDB2@liverpool.ac.uk>

Thanks very much for the replies. I've applied to get phred and will  
give that a try - sounds promising. I'll let you know how I get on.

Phil

From biopython at maubp.freeserve.co.uk  Mon Apr 26 12:39:40 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Mon, 26 Apr 2010 17:39:40 +0100
Subject: [EMBOSS] ABI to FASTQ with seqret
In-Reply-To: <4BD080F6.3060409@ebi.ac.uk>
References: <320fb6e01003300446g487fb954jdc94112224182772@mail.gmail.com>
	<4BB1F8F8.8050608@ebi.ac.uk> <4BB1FBE1.8030400@ebi.ac.uk>
	<320fb6e01003300656g6d9b5c28oe0f98f8deedbd484@mail.gmail.com>
	<i2i320fb6e01004220806m34bb1c66re9ae85df406c5f2a@mail.gmail.com>
	<4BD06999.2080502@ebi.ac.uk>
	<x2q320fb6e01004220848p386a567eg2a76d38689f8571f@mail.gmail.com>
	<4BD080F6.3060409@ebi.ac.uk>
Message-ID: <x2x320fb6e01004260939uf3141d8asfcc023dd5345bb3a@mail.gmail.com>

On Thu, Apr 22, 2010 at 6:01 PM, Peter Rice <pmr at ebi.ac.uk> wrote:
>> Does this mean there is an updated seqret in a public repository where I
>> can convert an ABI file to FASTQ taking the ABI basecaller's sequence
>> and PHRED scores? I'd be interested to test that... or a patch against
>> EMBOSS 6.2.0.
>
> It is in the latest CVS code and will appeart in the July release.

Thanks Peter,

I tried to grab this from the anonymous CVS mirror as per the EMBOSS
documentation here:
http://emboss.sourceforge.net/developers/cvs.html

Unfortunately it failed:

$ cvs -d :pserver:cvs at cvs.open-bio.org:/home/repository/emboss login
Logging in to :pserver:cvs at cvs.open-bio.org:2401/home/repository/emboss
CVS password:
cvs login: authorization failed: server cvs.open-bio.org rejected
access to /home/repository/emboss for user cvs

I know there have been VM problems on this machine (also known as
code.open-bio.org) which have been intermitently been affecting the
anonymous SVN access for other projects like BioPerl.

One short term solution would be to give my OBF username peterc
access to the master Emboss CVS repository on dev.open-bio.org
(joke), or look into an external mirror - for example BioPerl are using
github (and seriously talking about moving from SVN to git). This is
going even more off topic but since ViewCVS broke a while back, I've
found it much harder to browse the Emboss source code :(

Regards,

Peter C.

From n.celik00 at gmail.com  Mon Apr 26 23:13:08 2010
From: n.celik00 at gmail.com (Nermin Celik)
Date: Tue, 27 Apr 2010 13:13:08 +1000
Subject: [EMBOSS] Candidia
Message-ID: <v2q345d775d1004262013x1b3d1609v58618542394474b2@mail.gmail.com>

Hi,

I would like to translate yeast Candida albicans nucleotide sequence into
protein sequence using transeq. However I got confused with the '-table'
values.

The taxonomy information for candidia is:
*Lineage*<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=160764&lvl=3&lin=s&keep=1&srchmode=1&unlock>
(full): root<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Root&id=1&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
cellular organisms<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=131567&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Eukaryota<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=2759&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Fungi/Metazoa group<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=33154&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Metazoa<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=33208&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Eumetazoa<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=6072&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Bilateria<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=33213&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Coelomata<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=33316&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Deuterostomia<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=33511&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Chordata<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=7711&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Craniata<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=89593&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Vertebrata<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=7742&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Gnathostomata<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=7776&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Teleostomi<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=117570&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Euteleostomi<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=117571&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Actinopterygii<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=7898&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Actinopteri<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=186623&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Neopterygii<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=41665&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Teleostei<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=32443&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Elopocephala<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=186624&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Clupeocephala<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=186625&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Otocephala<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=186634&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Ostariophysi<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=32519&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Otophysi<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=186626&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Cypriniphysi<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=186627&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Cypriniformes<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=7952&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Cyprinoidea<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=30727&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Cyprinidae<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=7953&lvl=3&lin=f&keep=1&srchmode=1&unlock>

(retrieved from NCBI).

Based on the above information which '-table' value is best/suitable?

Nermin

From kiekyon.huang at gmail.com  Tue Apr 27 00:13:21 2010
From: kiekyon.huang at gmail.com (Kie Kyon Huang)
Date: Tue, 27 Apr 2010 12:13:21 +0800
Subject: [EMBOSS] extract sequence
Message-ID: <q2sa54400841004262113qad22f43dk9dff735b032bb5c8@mail.gmail.com>

Hi all

i need to extract a large number of sequences from the mouse genome.

I only have the location of the sequence,

I am wondering if emboss has any program to do this

Thanks

From gbottu at vub.ac.be  Tue Apr 27 12:02:40 2010
From: gbottu at vub.ac.be (Guy Bottu)
Date: Tue, 27 Apr 2010 18:02:40 +0200
Subject: [EMBOSS] question about XML manual
Message-ID: <4BD70AA0.2060509@vub.ac.be>

	Dear friends,

It is already some while that the EMBOSS staff started working on a new 
EMBOSS manual using the XMLmind software (and I contributed myself a 
part about wEMBOSS). Excuse me if I am asking a stupid question but I 
fail to find where the manual can be downloaded or consulted on-line.

	Regards,
	Guy Bottu

From jison at ebi.ac.uk  Tue Apr 27 12:30:23 2010
From: jison at ebi.ac.uk (Jon Ison)
Date: Tue, 27 Apr 2010 17:30:23 +0100 (BST)
Subject: [EMBOSS] question about XML manual
In-Reply-To: <4BD70AA0.2060509@vub.ac.be>
References: <4BD70AA0.2060509@vub.ac.be>
Message-ID: <33351.172.22.100.208.1272385823.squirrel@webmail.ebi.ac.uk>

Dear Guy and folks

For the time being, you can get the latest versions from my naff homepage:
http://www.ebi.ac.uk/~jison/

(in M$ word or HTML)

The versions there are not quite the final ones, but are not far off.  Soon, it'll all be moved to
a revamped EMBOSS website.  I'll make an announcement when that happens.

Cheers

Jon



> 	Dear friends,
>
> It is already some while that the EMBOSS staff started working on a new
> EMBOSS manual using the XMLmind software (and I contributed myself a
> part about wEMBOSS). Excuse me if I am asking a stupid question but I
> fail to find where the manual can be downloaded or consulted on-line.
>
> 	Regards,
> 	Guy Bottu
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss
>



From georgios at biotek.uio.no  Tue Apr 27 12:27:55 2010
From: georgios at biotek.uio.no (Georgios Magklaras)
Date: Tue, 27 Apr 2010 18:27:55 +0200
Subject: [EMBOSS] question about XML manual
In-Reply-To: <4BD70AA0.2060509@vub.ac.be>
References: <4BD70AA0.2060509@vub.ac.be>
Message-ID: <4BD7108B.5080607@biotek.uio.no>

I second that query.

GM

On 04/27/2010 06:02 PM, Guy Bottu wrote:
>     Dear friends,
>
> It is already some while that the EMBOSS staff started working on a 
> new EMBOSS manual using the XMLmind software (and I contributed myself 
> a part about wEMBOSS). Excuse me if I am asking a stupid question but 
> I fail to find where the manual can be downloaded or consulted on-line.
>
>     Regards,
>     Guy Bottu
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss


-- 
Best regards,
--

George Magklaras BSc (Hons) MPhil RHCE
IT Systems Manager/Senior Systems Engineer
The Biotechnology Center of Oslo
University of Oslo

http://www.biotek.uio.no
http://www.no.embnet.org
http://folk.uio.no/georgios



From michael.watson at bbsrc.ac.uk  Wed Apr 28 06:39:29 2010
From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C))
Date: Wed, 28 Apr 2010 11:39:29 +0100
Subject: [EMBOSS] Files needed for JASPEXTRACT
Message-ID: <8D08960C647E64438CE5740657CBBDC50236BBA349@iahcexch1.iah.bbsrc.ac.uk>

Hi

Hopefully I'm not missing anything obvious, but the doc for jaspextract states:

"The input files are the uncompressed and extracted JASPAR_CORE.tgz, JASPAR_FAM.tgz and JASPAR_PHYLOFACTS.tgz files provided in the JASPAR MatrixDir download directory of the JASPAR homepage"

I've had a look and can't find these files in the downloads section of http://jaspar.genereg.net/.

Is there somewhere else I need to look?

Mick




From simon.andrews at bbsrc.ac.uk  Wed Apr 28 07:07:14 2010
From: simon.andrews at bbsrc.ac.uk (simon andrews (BI))
Date: Wed, 28 Apr 2010 12:07:14 +0100
Subject: [EMBOSS] Files needed for JASPEXTRACT
In-Reply-To: <8D08960C647E64438CE5740657CBBDC50236BBA349@iahcexch1.iah.bbsrc.ac.uk>
References: <8D08960C647E64438CE5740657CBBDC50236BBA349@iahcexch1.iah.bbsrc.ac.uk>
Message-ID: <6884418F-3AAF-4821-B51C-5C76CE3C5E07@bbsrc.ac.uk>

Mick,

I asked this about a month ago and got a helpful answer...

http://www.mail-archive.com/emboss at lists.open-bio.org/msg01373.html

Simon.


On 28 Apr 2010, at 11:39, michael watson (IAH-C) wrote:

> Hi
> 
> Hopefully I'm not missing anything obvious, but the doc for jaspextract states:
> 
> "The input files are the uncompressed and extracted JASPAR_CORE.tgz, JASPAR_FAM.tgz and JASPAR_PHYLOFACTS.tgz files provided in the JASPAR MatrixDir download directory of the JASPAR homepage"
> 
> I've had a look and can't find these files in the downloads section of http://jaspar.genereg.net/.
> 
> Is there somewhere else I need to look?
> 
> Mick
> 
> 
> 
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss



From biopython at maubp.freeserve.co.uk  Wed Apr  7 09:36:24 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Wed, 7 Apr 2010 10:36:24 +0100
Subject: [EMBOSS] Nucleotide dotplots with EMBOSS
Message-ID: <x2m320fb6e01004070236tf088eabap79c1f2c56c5baf04@mail.gmail.com>

Hello EMBOSS team,

I've just been using dottup to produce dot plots comparing two
nucleotide sequences (two assemblies), where I have regions of very
high similarity but some inversions.
http://emboss.sourceforge.net/apps/release/6.2/emboss/apps/dottup.html

I've noticed that I can tell dotplot to reverse either of the
sequences, but I would actually like it to search both for forward
matches AND reverse matches to display on the same plot (ideally using
different colours). Is this possible already, or might it be a
reasonable feature request? Right now I can generate one plot with the
forward matches, and a second plot with the reverse matches - not
ideal.

Thanks,

Peter C.

P.S.
While I'm asking, I'd also like (colour) PDF output, since working
with PDF files is much easier on the Mac than postscript (which
thankfully is trivial to convert into PDF - so this isn't a big issue
for me).


From pmr at ebi.ac.uk  Wed Apr  7 11:01:06 2010
From: pmr at ebi.ac.uk (Peter Rice)
Date: Wed, 07 Apr 2010 12:01:06 +0100
Subject: [EMBOSS] Nucleotide dotplots with EMBOSS
In-Reply-To: <x2m320fb6e01004070236tf088eabap79c1f2c56c5baf04@mail.gmail.com>
References: <x2m320fb6e01004070236tf088eabap79c1f2c56c5baf04@mail.gmail.com>
Message-ID: <4BBC65F2.1080203@ebi.ac.uk>

On 07/04/2010 10:36, Peter Cock wrote:

> I've noticed that I can tell dotplot to reverse either of the
> sequences, but I would actually like it to search both for forward
> matches AND reverse matches to display on the same plot (ideally using
> different colours). Is this possible already, or might it be a
> reasonable feature request? Right now I can generate one plot with the
> forward matches, and a second plot with the reverse matches - not
> ideal.

Sounds like a reasonable request. We will look into it.

> While I'm asking, I'd also like (colour) PDF output, since working
> with PDF files is much easier on the Mac than postscript (which
> thankfully is trivial to convert into PDF - so this isn't a big issue
> for me).

Should be possible with plplot. We will look into adding PDF to the 
possible output devices.

regards,

Peter Rice


From biopython at maubp.freeserve.co.uk  Wed Apr  7 12:02:51 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Wed, 7 Apr 2010 13:02:51 +0100
Subject: [EMBOSS] Nucleotide dotplots with EMBOSS
In-Reply-To: <4BBC65F2.1080203@ebi.ac.uk>
References: <x2m320fb6e01004070236tf088eabap79c1f2c56c5baf04@mail.gmail.com>
	<4BBC65F2.1080203@ebi.ac.uk>
Message-ID: <w2r320fb6e01004070502j7d96ac22j6fa9d3c45edb21a5@mail.gmail.com>

On Wed, Apr 7, 2010 at 12:01 PM, Peter Rice <pmr at ebi.ac.uk> wrote:
> Sounds like a reasonable request. We will look into it.
> ...
> Should be possible with plplot. We will look into adding PDF to the possible
> output devices.

Great.

Thanks,

Peter


From koenvanderdrift at gmail.com  Fri Apr  9 00:08:43 2010
From: koenvanderdrift at gmail.com (Koen van der Drift)
Date: Thu, 8 Apr 2010 20:08:43 -0400
Subject: [EMBOSS] tfm cannot find doc files when building through fink (OS X)
Message-ID: <3C80F4C4-156F-430B-8858-5D9E52B62BB4@gmail.com>

Hi,

When building emboss through fink, tfm gets confused where the doc  
files are installed:

$ tfm -html water
Displays full documentation for an application
Died: No documentation found in /sw/src/fink.build/emboss-6.2.0-2/ 
EMBOSS-6.2.0/html/ for program 'water'.

So it looks in the build directory, not in the actual location: /sw/ 
share/EMBOSS/doc/programs/html

Is there a way to force tfm to look in /sw/share/EMBOSS/doc/programs/ 
html ?


Thanks,

- Koen.


From andrew.warry at bbsrc.ac.uk  Fri Apr  9 09:46:31 2010
From: andrew.warry at bbsrc.ac.uk (andrew warry (BITS))
Date: Fri, 9 Apr 2010 10:46:31 +0100
Subject: [EMBOSS] tfm cannot find doc files when building through fink
 (OS X)
In-Reply-To: <3C80F4C4-156F-430B-8858-5D9E52B62BB4@gmail.com>
References: <3C80F4C4-156F-430B-8858-5D9E52B62BB4@gmail.com>
Message-ID: <C57CE776344DFE4A8B8E254640024EE50BB5ABFBC0@bitsexch1.bits.bbsrc.ac.uk>

Hi,
The same problem with tfm -html occurs on Redhat ES5 and Ubuntu 9.10 - I just noticed, because this broke the help implementation when I updated my local Emboss-Explorer installations.

Andrew



-----Original Message-----
From: emboss-bounces at lists.open-bio.org [mailto:emboss-bounces at lists.open-bio.org] On Behalf Of Koen van der Drift
Sent: 09 April 2010 01:09
To: emboss at emboss.open-bio.org
Subject: [EMBOSS] tfm cannot find doc files when building through fink (OS X)

Hi,

When building emboss through fink, tfm gets confused where the doc  
files are installed:

$ tfm -html water
Displays full documentation for an application
Died: No documentation found in /sw/src/fink.build/emboss-6.2.0-2/ 
EMBOSS-6.2.0/html/ for program 'water'.

So it looks in the build directory, not in the actual location: /sw/ 
share/EMBOSS/doc/programs/html

Is there a way to force tfm to look in /sw/share/EMBOSS/doc/programs/ 
html ?


Thanks,

- Koen.
_______________________________________________
EMBOSS mailing list
EMBOSS at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/emboss

-- 
Disclaimer: This e-mail and any attachments are confidential and intended solely for the use of the recipient(s) to whom they are addressed. If you have received it in error, please destroy all copies and inform the sender. This email and any attachments are believed to be free from viruses but BBSRC accepts no liability in connection therewith. 




From frech.christian at gmail.com  Sat Apr 10 23:19:30 2010
From: frech.christian at gmail.com (Christian Frech)
Date: Sat, 10 Apr 2010 16:19:30 -0700
Subject: [EMBOSS] Increasing resolution of EMBOSS output images?
In-Reply-To: <h2te8aaa07a1004101434p2b559e30r52148eae16846a51@mail.gmail.com>
References: <h2te8aaa07a1004101434p2b559e30r52148eae16846a51@mail.gmail.com>
Message-ID: <4BC10782.6020409@googlemail.com>

Hi all,

I am using polyplot and dottup from the EMBOSS package to produce dot 
plots. It works fine, but the resolution of the output images (PNG 
files) is too low to examine matches in detail. Is there a way to 
increase the resolution of output images?

Christian


From biopython at maubp.freeserve.co.uk  Tue Apr 13 11:43:08 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Tue, 13 Apr 2010 12:43:08 +0100
Subject: [EMBOSS] EMBOSS eprimer3 and latest primer3_core
Message-ID: <r2m320fb6e01004130443uaa5da081w79b25edb80a97b6a@mail.gmail.com>

Hello EMBOSS team,

I'm using EMBOSS 6.2.0 on Mac OS X 10.6.3 Snow Leopard:

$ embossversion
Reports the current EMBOSS version number
6.2.0

I need to design some primers so I wanted to try the EMBOSS tool
eprimer3, which as your documentation clearly explains requires me to
install the 'primer3' program from the Whitehead Institute
(specifically the primer3_core tool).

I downloaded and compiled the latest version of primer3, version 2.2.2
beta (using the default, i.e. just "make", which seems to be fine -
the Snow Leopard specific Makefile failed). It seems that EMBOSS
eprimer3 does not like this:

$ export EMBOSS_PRIMER3_CORE="/Users/xxx/Downloads/Software/primer3-2.2.2-beta/src/primer3_core"
$ eprimer3 fasta::lupine.nu lupine.eprimer3
Picks PCR primers and hybridization oligos
Error: Missing SEQUENCE tag

Instead, I downloaded and compiled primer3 version 1.1.4 (using the
defaults, i.e. just "make", there is no Snow Leopard specific Makefile
included) and that seems to work:

$ export EMBOSS_PRIMER3_CORE="/Users/xxx/Downloads/Software/primer3-1.1.4/src/primer3_core"
$ eprimer3 fasta::lupine.nu lupine.eprimer3Picks PCR primers and
hybridization oligos
Picks PCR primers and hybridization oligos

The eprimer3 output looks sensible too.

My guess is that something in the recent primer3 alpha and beta
releases of 2.x.x has changed since version 1.x.x and that EMBOSS
needs to be updated to cope. Is this a known issue?

Thanks,

Peter C.


From biopython at maubp.freeserve.co.uk  Tue Apr 13 12:44:28 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Tue, 13 Apr 2010 13:44:28 +0100
Subject: [EMBOSS] EMBOSS eprimer3 and ambiguous DNA
Message-ID: <u2o320fb6e01004130544x35d7c80ao16bf82f60bdcdb67@mail.gmail.com>

Hello again,

I just ran eprimer3 on a multiple FASTA file (using published genome
sequences), and noticed a couple of messages:

"Error: Unrecognized base in input sequence"

Additionally, for two of the sequences there were no primer pairs (just
some blank lines instead). These appear to correspond to two of the
sequences in my input which had IUPAC ambiguous characters in the
sequence (e.g. R, W, Y, N). The eprimer3 documentation does say
explicitly that for some input files such characters are converted into
N (options -mispriminglibraryfile and -mishyblibraryfile) .

What is supposed to happen in a sequence in the main input file has
such characters?

I would expect to still get back a candidate set of primers (even if they
do not cover the regions with ambiguous letters).

As an experiment I added an N character to the end of an unambiguous
sequence, and eprimer3 seemed happy. So, as a work around I've simply
replaced all the ambiguous characters (like R, W and Y) with N, and it
seems to work. Maybe eprimer3 could do this for me, or at least have
this limitation mentioned in the documentation?

Thanks,

Peter C.


From kellert at ohsu.edu  Tue Apr 13 19:07:22 2010
From: kellert at ohsu.edu (Tom Keller)
Date: Tue, 13 Apr 2010 12:07:22 -0700
Subject: [EMBOSS] EMBOSS eprimer3 and latest primer3_core
In-Reply-To: <r2m320fb6e01004130443uaa5da081w79b25edb80a97b6a@mail.gmail.com>
References: <r2m320fb6e01004130443uaa5da081w79b25edb80a97b6a@mail.gmail.com>
Message-ID: <95EED66E-037B-4E79-9B87-56DBA28578A1@ohsu.edu>

Hi,
I've just installed the beta version of primer3-2.2.2 also. The boulder_io format has been changed. For example, instead of 
SEQUENCE=ACGT....
the new tag is
SEQUENCE_TEMPLATE=ACGT...
also, notice the underscores (they are hard to see in the html manual, cause of the link markup)

I tested primer3_core. It works with this example:
SEQUENCE_ID=PT203_A02
SEQUENCE_TEMPLATE=GTGCCGTGCTCGGCTTCTCTGGTCACAGTCTTTTGTCTCTAGGGCTAAGACAGTGCCTGTCCCTGAAAAGTGGACCACTCCTCAAGAGATAAAACAAAAGATCCAACTCCTCCACCAGAAGTCAGAGTTTGTGGAGAAGAGCACAAAGTACTTCTCAGGTAGATGGGCTTGGGAGAAGATTGGAGGTGCATGCTCACTTCCTCCCTAAGATCCACATAGCCCAGAGCCCCTCACTTCCCTCCTCTTCCCCTGGTCTTGCTGACCTGCCTTCAACCTCTCCTCCATCTGTCCCTGGCTGAGGGACCTAACTCCAGCTTCTCTCTGCTCCCTTTCCCACATTTTAGAAACCCTGCGTTCAGAAATGGAAATGTTCAATGGTGAGTCCAGCGGTAATGGTGTGTGCTGGCCTGGGGTTGTTGCAGTGTTCCCTTGTGCTGTTGACTTGAGGGGCCCTATTTAGAAGACAAAAAAAAAACCAAACACCTGGGGGCAAAAGTAAAA
SEQUENCE_TARGET=395,12
PRIMER_TASK=pick_detection_primers
PRIMER_PICK_LEFT=1
PRIMER_PICK_INTERNAL=1
PRIMER_PICK_RIGHT=1
PRIMER_OPT_SIZE=20
PRIMER_MIN_SIZE=17
PRIMER_MAX_SIZE=23
PRIMER_MAX_NS_ACCEPTED=1
PRIMER_PRODUCT_SIZE_RANGE=75-300
P3_FILE_FLAG=1
PRIMER_EXPLAIN_FLAG=1
=

But eprimer3 dies:
Error: Unable to read sequence './boulderio_template.txt'
Died: eprimer3 terminated: Bad value for '-sequence' and no prompt

Is it that the new format has not yet been accommodated?


thanks,
Tom

Thomas (Tom) Keller, PhD
kellert at ohsu.edu
503.494.2442
6339b R Jones Hall (BSc/CROET)
www.ohsu.edu/xd/research/research-cores/dna-analysis/

On Apr 13, 2010, at 4:43 AM, Peter wrote:

> Hello EMBOSS team,
> 
> I'm using EMBOSS 6.2.0 on Mac OS X 10.6.3 Snow Leopard:
> 
> $ embossversion
> Reports the current EMBOSS version number
> 6.2.0
> 
> I need to design some primers so I wanted to try the EMBOSS tool
> eprimer3, which as your documentation clearly explains requires me to
> install the 'primer3' program from the Whitehead Institute
> (specifically the primer3_core tool).
> 
> I downloaded and compiled the latest version of primer3, version 2.2.2
> beta (using the default, i.e. just "make", which seems to be fine -
> the Snow Leopard specific Makefile failed). It seems that EMBOSS
> eprimer3 does not like this:
> 
> $ export EMBOSS_PRIMER3_CORE="/Users/xxx/Downloads/Software/primer3-2.2.2-beta/src/primer3_core"
> $ eprimer3 fasta::lupine.nu lupine.eprimer3
> Picks PCR primers and hybridization oligos
> Error: Missing SEQUENCE tag
> 
> Instead, I downloaded and compiled primer3 version 1.1.4 (using the
> defaults, i.e. just "make", there is no Snow Leopard specific Makefile
> included) and that seems to work:
> 
> $ export EMBOSS_PRIMER3_CORE="/Users/xxx/Downloads/Software/primer3-1.1.4/src/primer3_core"
> $ eprimer3 fasta::lupine.nu lupine.eprimer3Picks PCR primers and
> hybridization oligos
> Picks PCR primers and hybridization oligos
> 
> The eprimer3 output looks sensible too.
> 
> My guess is that something in the recent primer3 alpha and beta
> releases of 2.x.x has changed since version 1.x.x and that EMBOSS
> needs to be updated to cope. Is this a known issue?
> 
> Thanks,
> 
> Peter C.
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss




From ajb at ebi.ac.uk  Tue Apr 13 20:15:42 2010
From: ajb at ebi.ac.uk (ajb at ebi.ac.uk)
Date: Tue, 13 Apr 2010 21:15:42 +0100 (BST)
Subject: [EMBOSS] EMBOSS eprimer3 and latest primer3_core
In-Reply-To: <95EED66E-037B-4E79-9B87-56DBA28578A1@ohsu.edu>
References: <r2m320fb6e01004130443uaa5da081w79b25edb80a97b6a@mail.gmail.com>
	<95EED66E-037B-4E79-9B87-56DBA28578A1@ohsu.edu>
Message-ID: <40862.86.26.12.63.1271189742.squirrel@webmail.ebi.ac.uk>

Hi,

A conversion was done on eprimer3.c earlier today to
use the new tag names. That was the easy bit. The hard bit
is deciding on names for the new and old version (we
intend having two versions for now and retiring the current, stable,
version at some stage).

Alan


> Hi,
> I've just installed the beta version of primer3-2.2.2 also. The boulder_io
> format has been changed. For example, instead of
> SEQUENCE=ACGT....
> the new tag is
> SEQUENCE_TEMPLATE=ACGT...
> also, notice the underscores (they are hard to see in the html manual,
> cause of the link markup)
>
> I tested primer3_core. It works with this example:
> SEQUENCE_ID=PT203_A02
> SEQUENCE_TEMPLATE=GTGCCGTGCTCGGCTTCTCTGGTCACAGTCTTTTGTCTCTAGGGCTAAGACAGTGCCTGTCCCTGAAAAGTGGACCACTCCTCAAGAGATAAAACAAAAGATCCAACTCCTCCACCAGAAGTCAGAGTTTGTGGAGAAGAGCACAAAGTACTTCTCAGGTAGATGGGCTTGGGAGAAGATTGGAGGTGCATGCTCACTTCCTCCCTAAGATCCACATAGCCCAGAGCCCCTCACTTCCCTCCTCTTCCCCTGGTCTTGCTGACCTGCCTTCAACCTCTCCTCCATCTGTCCCTGGCTGAGGGACCTAACTCCAGCTTCTCTCTGCTCCCTTTCCCACATTTTAGAAACCCTGCGTTCAGAAATGGAAATGTTCAATGGTGAGTCCAGCGGTAATGGTGTGTGCTGGCCTGGGGTTGTTGCAGTGTTCCCTTGTGCTGTTGACTTGAGGGGCCCTATTTAGAAGACAAAAAAAAAACCAAACACCTGGGGGCAAAAGTAAAA
> SEQUENCE_TARGET=395,12
> PRIMER_TASK=pick_detection_primers
> PRIMER_PICK_LEFT=1
> PRIMER_PICK_INTERNAL=1
> PRIMER_PICK_RIGHT=1
> PRIMER_OPT_SIZE=20
> PRIMER_MIN_SIZE=17
> PRIMER_MAX_SIZE=23
> PRIMER_MAX_NS_ACCEPTED=1
> PRIMER_PRODUCT_SIZE_RANGE=75-300
> P3_FILE_FLAG=1
> PRIMER_EXPLAIN_FLAG=1
> =
>
> But eprimer3 dies:
> Error: Unable to read sequence './boulderio_template.txt'
> Died: eprimer3 terminated: Bad value for '-sequence' and no prompt
>
> Is it that the new format has not yet been accommodated?
>
>
> thanks,
> Tom
>
> Thomas (Tom) Keller, PhD
> kellert at ohsu.edu
> 503.494.2442
> 6339b R Jones Hall (BSc/CROET)
> www.ohsu.edu/xd/research/research-cores/dna-analysis/
>
> On Apr 13, 2010, at 4:43 AM, Peter wrote:
>
>> Hello EMBOSS team,
>>
>> I'm using EMBOSS 6.2.0 on Mac OS X 10.6.3 Snow Leopard:
>>
>> $ embossversion
>> Reports the current EMBOSS version number
>> 6.2.0
>>
>> I need to design some primers so I wanted to try the EMBOSS tool
>> eprimer3, which as your documentation clearly explains requires me to
>> install the 'primer3' program from the Whitehead Institute
>> (specifically the primer3_core tool).
>>
>> I downloaded and compiled the latest version of primer3, version 2.2.2
>> beta (using the default, i.e. just "make", which seems to be fine -
>> the Snow Leopard specific Makefile failed). It seems that EMBOSS
>> eprimer3 does not like this:
>>
>> $ export
>> EMBOSS_PRIMER3_CORE="/Users/xxx/Downloads/Software/primer3-2.2.2-beta/src/primer3_core"
>> $ eprimer3 fasta::lupine.nu lupine.eprimer3
>> Picks PCR primers and hybridization oligos
>> Error: Missing SEQUENCE tag
>>
>> Instead, I downloaded and compiled primer3 version 1.1.4 (using the
>> defaults, i.e. just "make", there is no Snow Leopard specific Makefile
>> included) and that seems to work:
>>
>> $ export
>> EMBOSS_PRIMER3_CORE="/Users/xxx/Downloads/Software/primer3-1.1.4/src/primer3_core"
>> $ eprimer3 fasta::lupine.nu lupine.eprimer3Picks PCR primers and
>> hybridization oligos
>> Picks PCR primers and hybridization oligos
>>
>> The eprimer3 output looks sensible too.
>>
>> My guess is that something in the recent primer3 alpha and beta
>> releases of 2.x.x has changed since version 1.x.x and that EMBOSS
>> needs to be updated to cope. Is this a known issue?
>>
>> Thanks,
>>
>> Peter C.
>> _______________________________________________
>> EMBOSS mailing list
>> EMBOSS at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/emboss
>
>
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss
>




From pmr at ebi.ac.uk  Wed Apr 14 09:45:15 2010
From: pmr at ebi.ac.uk (Peter Rice)
Date: Wed, 14 Apr 2010 10:45:15 +0100
Subject: [EMBOSS] Why always Guide protein sequence xxx not found in
 nucleic sequence xxx??
In-Reply-To: <OF52A42504.A98A6162-ON86257705.00147981-86257705.001508C0@unomaha.edu>
References: <OF52A42504.A98A6162-ON86257705.00147981-86257705.001508C0@unomaha.edu>
Message-ID: <4BC58EAB.9060803@ebi.ac.uk>

On 14/04/2010 04:49, Jianpeng Xu wrote:
> Hi,
>
> I am a researcher in US.
>
> I'm trying to use tranalign to align DNA sequences but it
> keeps throwing errors.  I tested it on the example input files from
> the documentation web pages and those work fine.
>
> Error: Guide protein sequence SS1G01814 not found in nucleic sequence
> SS1G01814
>
> it throws the same error for every pair of proteins in the file.
>
> May you tell me the reason?

"Pair of proteins" sounds odd ... the first set of sequences are the 
nucleotide coding sequences. The second set of sequences are the protein 
translations.

If you send some example sequneces to emboss-bug at emboss.open-bio.org we 
can take a look and tell you excatly why you get the message.

regards,

Peter Rice


From korndoerfer at crelux.com  Fri Apr 16 09:18:11 2010
From: korndoerfer at crelux.com (Ingo P. Korndoerfer)
Date: Fri, 16 Apr 2010 11:18:11 +0200
Subject: [EMBOSS] showalign: maintain numbering of the reference sequence
Message-ID: <4BC82B53.2060504@crelux.com>

dear fellow emboss users,

who can help me out with this one:

we URGENTLY need some commandline driven program, that nicely displays
emma output, BUT MAINTAINS the sequence numbering of the reference sequence.

showalign seems to simply start counting at the first residue, even if
it is a construct with just a purification tag, and happily includes
alignment gaps in the numbering.

this makes it real difficult for us to find a certain residue of a
protein in our alignment, particularly important if the whole team wants
to discuss certain details ...

i have tried the refseq keyword, but that did not seem to do that ...

any ideas, i'd be happy. would be nice if it were in emboss, since that
is installed on all machines already, but if need to, we can install
additional software ...

greetings

ingo

-------------- next part --------------
A non-text attachment was scrubbed...
Name: korndoerfer.vcf
Type: text/x-vcard
Size: 318 bytes
Desc: not available
URL: <http://lists.open-bio.org/pipermail/emboss/attachments/20100416/faf7d38e/attachment-0002.vcf>

From pmr at ebi.ac.uk  Fri Apr 16 10:35:29 2010
From: pmr at ebi.ac.uk (Peter Rice)
Date: Fri, 16 Apr 2010 11:35:29 +0100
Subject: [EMBOSS] showalign: maintain numbering of the reference sequence
In-Reply-To: <4BC82B53.2060504@crelux.com>
References: <4BC82B53.2060504@crelux.com>
Message-ID: <4BC83D71.4060905@ebi.ac.uk>

Dear Ingo,

On 16/04/2010 10:18, Ingo P. Korndoerfer wrote:
> dear fellow emboss users,
>
> who can help me out with this one:
>
> we URGENTLY need some commandline driven program, that nicely displays
> emma output, BUT MAINTAINS the sequence numbering of the reference sequence.

Interesting. Emma output is just a multiply aligned sequence file in any 
format.

> showalign seems to simply start counting at the first residue, even if
> it is a construct with just a purification tag, and happily includes
> alignment gaps in the numbering.

Showalign is the obvious application to update.

> this makes it real difficult for us to find a certain residue of a
> protein in our alignment, particularly important if the whole team wants
> to discuss certain details ...
>
> i have tried the refseq keyword, but that did not seem to do that ...

We can change that. Refseq is used to make one sequence appear first and be 
used to control numbering too. The ouptut of showalign is a text file (it 
does not write out an align object) so we are free to modify it.

The easiest is to add an option to number by the reference sequence when 
the ruler appears.

We can also add a test for a sequence ID matching without being case 
sensitive to make the -refseq option easier to use.

> any ideas, i'd be happy. would be nice if it were in emboss, since that
> is installed on all machines already, but if need to, we can install
> additional software ...

Happy to help. If you can give some examples of what you would like we can 
send you a version to test and then add it to the July release.

regards,

Peter Rice


From Kevin.Clancy at lifetech.com  Fri Apr 16 19:01:22 2010
From: Kevin.Clancy at lifetech.com (Clancy, Kevin)
Date: Fri, 16 Apr 2010 12:01:22 -0700
Subject: [EMBOSS] File standards for reporting analysis tool results
Message-ID: <211C19306C13A84B9A2712D3D22F5201D5AEC1051E@CBD01MAIL02.ads.invitrogen.net>

Folks
I'm trying to identify if there are any well supported file formats that folk use for reporting results from analysis tools. So MSA or Nexus formats have been devised for multiple alignments and phylogenetics analyses. The work being done on SAM/BAM files standardizes reporting mapped next gen data, eg with CIGAR strings. There has been some use of GFF and BAM files for reporting parts of an analysis. I was wondering if there was a generalized format used by EMBOSS tools to standardize their outputs? Has anyone used BSML or other file formats standards in this fashion?

Thanks for your feedback.
kevin

Kevin Clancy, PhD
Invitrogen: Life tech
Carlsbad, CA 92008





From jison at ebi.ac.uk  Thu Apr 22 14:52:47 2010
From: jison at ebi.ac.uk (Jon Ison)
Date: Thu, 22 Apr 2010 15:52:47 +0100 (BST)
Subject: [EMBOSS] Workshop for Web Service Providers
Message-ID: <60512.172.22.100.208.1271947967.squirrel@webmail.ebi.ac.uk>

Dear embossnians

The workshop below will introduce comprehensive guidelines for design, semantic annotation and
publishing of SOAP-based Web Services in the area of life sciences.

http://www.cbs.dtu.dk/courses/embrace/2010-06-02/

Please take a look

Cheers

Jon



From biopython at maubp.freeserve.co.uk  Thu Apr 22 15:06:27 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Thu, 22 Apr 2010 16:06:27 +0100
Subject: [EMBOSS] ABI to FASTQ with seqret
In-Reply-To: <320fb6e01003300656g6d9b5c28oe0f98f8deedbd484@mail.gmail.com>
References: <320fb6e01003300446g487fb954jdc94112224182772@mail.gmail.com>
	<4BB1F8F8.8050608@ebi.ac.uk> <4BB1FBE1.8030400@ebi.ac.uk>
	<320fb6e01003300656g6d9b5c28oe0f98f8deedbd484@mail.gmail.com>
Message-ID: <i2i320fb6e01004220806m34bb1c66re9ae85df406c5f2a@mail.gmail.com>

On Tue, Mar 30, 2010 at 2:56 PM, Peter <biopython at maubp.freeserve.co.uk> wrote:
> On Tue, Mar 30, 2010 at 2:25 PM, Peter Rice <pmr at ebi.ac.uk> wrote:
>>
>> On 30/03/2010 14:13, Peter Rice wrote:
>>
>>> Where do I look to find scores that we can use (and how do we convert
>>> those to phred quality scores)?
>>
>> Aha, found something. The field is called PCON (confidence values), with
>> values 0-255.
>>
>> There is a possibility that these could be phred scores, but I suspect they
>> are whatever the basecaller has decided to write there.
>>
>> http://www.appliedbiosystems.com/support/software_community/ABIF_File_Format.pdf
>>
>> Peter R.
>
> Hmm. Good question - I don't know, although if they are PHRED scores
> they could go unusually high (we'd expect say 0 to 50 for a raw read).
> It could be some other encoding (e.g. scaled from 0 for a poor base to
> 255 for a perfect base). Do you have any contacts at Applied Biosystems
> to ask?
>
> Peter C.
>

Hello again Peter R (& everyone else at EMBOSS),

Did you manage to find out if the PCON confidence values in ABI files
are PHRED quality scores or not?

Regards,

Peter C.


From pmr at ebi.ac.uk  Thu Apr 22 15:22:01 2010
From: pmr at ebi.ac.uk (Peter Rice)
Date: Thu, 22 Apr 2010 16:22:01 +0100
Subject: [EMBOSS] ABI to FASTQ with seqret
In-Reply-To: <i2i320fb6e01004220806m34bb1c66re9ae85df406c5f2a@mail.gmail.com>
References: <320fb6e01003300446g487fb954jdc94112224182772@mail.gmail.com>	
	<4BB1F8F8.8050608@ebi.ac.uk> <4BB1FBE1.8030400@ebi.ac.uk>	
	<320fb6e01003300656g6d9b5c28oe0f98f8deedbd484@mail.gmail.com>
	<i2i320fb6e01004220806m34bb1c66re9ae85df406c5f2a@mail.gmail.com>
Message-ID: <4BD06999.2080502@ebi.ac.uk>

On 22/04/2010 16:06, Peter C. wrote:

> Hello again Peter R (&  everyone else at EMBOSS),
>
> Did you manage to find out if the PCON confidence values in ABI files
> are PHRED quality scores or not?

Yes ... and maybe.

The first scores are written bu the ABI basecaller.

A second set can be written by any basecaller. These may be phred quality 
scores but could in theory be anything.

EMBOSS will assume they are phred scores as there is no way to tell otherwise.

regards,

Peter Rice


From biopython at maubp.freeserve.co.uk  Thu Apr 22 15:48:29 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Thu, 22 Apr 2010 16:48:29 +0100
Subject: [EMBOSS] ABI to FASTQ with seqret
In-Reply-To: <4BD06999.2080502@ebi.ac.uk>
References: <320fb6e01003300446g487fb954jdc94112224182772@mail.gmail.com>
	<4BB1F8F8.8050608@ebi.ac.uk> <4BB1FBE1.8030400@ebi.ac.uk>
	<320fb6e01003300656g6d9b5c28oe0f98f8deedbd484@mail.gmail.com>
	<i2i320fb6e01004220806m34bb1c66re9ae85df406c5f2a@mail.gmail.com>
	<4BD06999.2080502@ebi.ac.uk>
Message-ID: <x2q320fb6e01004220848p386a567eg2a76d38689f8571f@mail.gmail.com>

On Thu, Apr 22, 2010 at 4:22 PM, Peter Rice <pmr at ebi.ac.uk> wrote:
>
> On 22/04/2010 16:06, Peter C. wrote:
>
>> Hello again Peter R (& ?everyone else at EMBOSS),
>>
>> Did you manage to find out if the PCON confidence values in ABI files
>> are PHRED quality scores or not?
>
> Yes ... and maybe.
>
> The first scores are written bu the ABI basecaller.
>
> A second set can be written by any basecaller. These may be phred quality
> scores but could in theory be anything.
>
> EMBOSS will assume they are phred scores as there is no way to tell
> otherwise.
>
> regards,
>
> Peter Rice

Does this mean there is an updated seqret in a public repository where I
can convert an ABI file to FASTQ taking the ABI basecaller's sequence
and PHRED scores? I'd be interested to test that... or a patch against
EMBOSS 6.2.0.

Thanks,

Peter C.



From pmr at ebi.ac.uk  Thu Apr 22 17:01:42 2010
From: pmr at ebi.ac.uk (Peter Rice)
Date: Thu, 22 Apr 2010 18:01:42 +0100
Subject: [EMBOSS] ABI to FASTQ with seqret
In-Reply-To: <x2q320fb6e01004220848p386a567eg2a76d38689f8571f@mail.gmail.com>
References: <320fb6e01003300446g487fb954jdc94112224182772@mail.gmail.com>	
	<4BB1F8F8.8050608@ebi.ac.uk> <4BB1FBE1.8030400@ebi.ac.uk>	
	<320fb6e01003300656g6d9b5c28oe0f98f8deedbd484@mail.gmail.com>	
	<i2i320fb6e01004220806m34bb1c66re9ae85df406c5f2a@mail.gmail.com>	
	<4BD06999.2080502@ebi.ac.uk>
	<x2q320fb6e01004220848p386a567eg2a76d38689f8571f@mail.gmail.com>
Message-ID: <4BD080F6.3060409@ebi.ac.uk>

On 22/04/2010 16:48, Peter Cock wrote:

> Does this mean there is an updated seqret in a public repository where I
> can convert an ABI file to FASTQ taking the ABI basecaller's sequence
> and PHRED scores? I'd be interested to test that... or a patch against
> EMBOSS 6.2.0.

It is in the latest CVS code and will appeart in the July release.

regards,

Peter Rice


From koenvanderdrift at gmail.com  Thu Apr 22 23:03:05 2010
From: koenvanderdrift at gmail.com (Koen van der Drift)
Date: Thu, 22 Apr 2010 19:03:05 -0400
Subject: [EMBOSS] accessing emboss ftp site
Message-ID: <6F57C2D1-8927-420C-940C-C6EC0C62AABE@gmail.com>

Hi,

For a while now I am unable to access the emboss ftp site using the OS  
X client Transmit. Loggin in works fine, but it chokes on the LIST  
command. I have no problems accessing it from the command line. I have  
added the output from Transmit below. I don't know if this is a  
Transmit or emboss issue, but just wanted to let you know.

Thanks,

- Koen.


Transmit 3.6.9 Session Transcript
LibNcFTP 3.2.1 (August 13, 2007) compiled for UNIX
Uname: Darwin|exile.local|9.8.0|Darwin Kernel Version 9.8.0: Wed Jul  
15 16:57:01 PDT 2009; root:xnu-1228.15.4~1/RELEASE_PPC|Power Macintosh
220: (vsFTPd 2.0.1)
Connected to emboss.open-bio.org.
Cmd: USER anonymous
331: Please specify the password.
Cmd: PASS NcFTP@
230: Login successful.
Cmd: TYPE A
200: Switching to ASCII mode.
Logged in to emboss.open-bio.org as anonymous.
Cmd: SYST
215: UNIX Type: L8
Cmd: PWD
257: "/"
Cmd: CWD /pub/EMBOSS/fixes
250: Directory successfully changed.
Cmd: PWD
257: "/pub/EMBOSS/fixes"
Cmd: PASV
227: Entering Passive Mode (208,94,50,58,83,232)
Cmd: LIST -a
Could not read reply from control connection -- timed out. (SReadline 1)
220: (vsFTPd 2.0.1)
Connected to emboss.open-bio.org.
Cmd: USER anonymous
331: Please specify the password.
Cmd: PASS NcFTP@
230: Login successful.
Logged in to emboss.open-bio.org as anonymous.
Cmd: SYST
215: UNIX Type: L8
Cmd: PWD
257: "/"
Cmd: CWD /pub/EMBOSS/fixes
250: Directory successfully changed.
Cmd: PWD
257: "/pub/EMBOSS/fixes"
Cmd: PASV
227: Entering Passive Mode (208,94,50,58,222,100)
Cmd: LIST -a
Could not read reply from control connection -- timed out. (SReadline 1)



From dag at sonsorol.org  Thu Apr 22 23:28:27 2010
From: dag at sonsorol.org (Chris Dagdigian)
Date: Thu, 22 Apr 2010 19:28:27 -0400
Subject: [EMBOSS] accessing emboss ftp site
In-Reply-To: <6F57C2D1-8927-420C-940C-C6EC0C62AABE@gmail.com>
References: <6F57C2D1-8927-420C-940C-C6EC0C62AABE@gmail.com>
Message-ID: <4BD0DB9B.5050005@sonsorol.org>


Might be an issue with the Juniper Netscreen firewall/IDS security 
appliance that sits upstream of the EMBOSS FTP server. I'll take a look 
at the security logs and alerts.

-Chris


Koen van der Drift wrote:
> Hi,
>
> For a while now I am unable to access the emboss ftp site using the OS X
> client Transmit. Loggin in works fine, but it chokes on the LIST
> command. I have no problems accessing it from the command line. I have
> added the output from Transmit below. I don't know if this is a Transmit
> or emboss issue, but just wanted to let you know.
>
> Thanks,
>
> - Koen.
>
>
> Transmit 3.6.9 Session Transcript
> LibNcFTP 3.2.1 (August 13, 2007) compiled for UNIX
> Uname: Darwin|exile.local|9.8.0|Darwin Kernel Version 9.8.0: Wed Jul 15
> 16:57:01 PDT 2009; root:xnu-1228.15.4~1/RELEASE_PPC|Power Macintosh
> 220: (vsFTPd 2.0.1)
> Connected to emboss.open-bio.org.
> Cmd: USER anonymous
> 331: Please specify the password.
> Cmd: PASS NcFTP@
> 230: Login successful.
> Cmd: TYPE A
> 200: Switching to ASCII mode.
> Logged in to emboss.open-bio.org as anonymous.
> Cmd: SYST
> 215: UNIX Type: L8
> Cmd: PWD
> 257: "/"
> Cmd: CWD /pub/EMBOSS/fixes
> 250: Directory successfully changed.
> Cmd: PWD
> 257: "/pub/EMBOSS/fixes"
> Cmd: PASV
> 227: Entering Passive Mode (208,94,50,58,83,232)
> Cmd: LIST -a
> Could not read reply from control connection -- timed out. (SReadline 1)
> 220: (vsFTPd 2.0.1)
> Connected to emboss.open-bio.org.
> Cmd: USER anonymous
> 331: Please specify the password.
> Cmd: PASS NcFTP@
> 230: Login successful.
> Logged in to emboss.open-bio.org as anonymous.
> Cmd: SYST
> 215: UNIX Type: L8
> Cmd: PWD
> 257: "/"
> Cmd: CWD /pub/EMBOSS/fixes
> 250: Directory successfully changed.
> Cmd: PWD
> 257: "/pub/EMBOSS/fixes"
> Cmd: PASV
> 227: Entering Passive Mode (208,94,50,58,222,100)
> Cmd: LIST -a
> Could not read reply from control connection -- timed out. (SReadline 1)
>
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss


From koenvanderdrift at gmail.com  Fri Apr 23 14:56:45 2010
From: koenvanderdrift at gmail.com (Koen van der Drift)
Date: Fri, 23 Apr 2010 10:56:45 -0400
Subject: [EMBOSS] accessing emboss ftp site
In-Reply-To: <4BD0DB9B.5050005@sonsorol.org>
References: <6F57C2D1-8927-420C-940C-C6EC0C62AABE@gmail.com>
	<4BD0DB9B.5050005@sonsorol.org>
Message-ID: <l2o5cba6b9f1004230756gf04316acq8519b375ce29e0d8@mail.gmail.com>

Just for the record, it used to work with Transmit, this is only from
the last few months.

- Koen.

On Thu, Apr 22, 2010 at 7:28 PM, Chris Dagdigian <dag at sonsorol.org> wrote:
>
> Might be an issue with the Juniper Netscreen firewall/IDS security appliance
> that sits upstream of the EMBOSS FTP server. I'll take a look at the
> security logs and alerts.
>
> -Chris
>
>
> Koen van der Drift wrote:
>>
>> Hi,
>>
>> For a while now I am unable to access the emboss ftp site using the OS X
>> client Transmit. Loggin in works fine, but it chokes on the LIST
>> command. I have no problems accessing it from the command line. I have
>> added the output from Transmit below. I don't know if this is a Transmit
>> or emboss issue, but just wanted to let you know.
>>
>> Thanks,
>>
>> - Koen.
>>
>>
>> Transmit 3.6.9 Session Transcript
>> LibNcFTP 3.2.1 (August 13, 2007) compiled for UNIX
>> Uname: Darwin|exile.local|9.8.0|Darwin Kernel Version 9.8.0: Wed Jul 15
>> 16:57:01 PDT 2009; root:xnu-1228.15.4~1/RELEASE_PPC|Power Macintosh
>> 220: (vsFTPd 2.0.1)
>> Connected to emboss.open-bio.org.
>> Cmd: USER anonymous
>> 331: Please specify the password.
>> Cmd: PASS NcFTP@
>> 230: Login successful.
>> Cmd: TYPE A
>> 200: Switching to ASCII mode.
>> Logged in to emboss.open-bio.org as anonymous.
>> Cmd: SYST
>> 215: UNIX Type: L8
>> Cmd: PWD
>> 257: "/"
>> Cmd: CWD /pub/EMBOSS/fixes
>> 250: Directory successfully changed.
>> Cmd: PWD
>> 257: "/pub/EMBOSS/fixes"
>> Cmd: PASV
>> 227: Entering Passive Mode (208,94,50,58,83,232)
>> Cmd: LIST -a
>> Could not read reply from control connection -- timed out. (SReadline 1)
>> 220: (vsFTPd 2.0.1)
>> Connected to emboss.open-bio.org.
>> Cmd: USER anonymous
>> 331: Please specify the password.
>> Cmd: PASS NcFTP@
>> 230: Login successful.
>> Logged in to emboss.open-bio.org as anonymous.
>> Cmd: SYST
>> 215: UNIX Type: L8
>> Cmd: PWD
>> 257: "/"
>> Cmd: CWD /pub/EMBOSS/fixes
>> 250: Directory successfully changed.
>> Cmd: PWD
>> 257: "/pub/EMBOSS/fixes"
>> Cmd: PASV
>> 227: Entering Passive Mode (208,94,50,58,222,100)
>> Cmd: LIST -a
>> Could not read reply from control connection -- timed out. (SReadline 1)
>>
>> _______________________________________________
>> EMBOSS mailing list
>> EMBOSS at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/emboss
>


From dag at sonsorol.org  Fri Apr 23 15:44:29 2010
From: dag at sonsorol.org (Chris Dagdigian)
Date: Fri, 23 Apr 2010 11:44:29 -0400
Subject: [EMBOSS] accessing emboss ftp site
In-Reply-To: <l2o5cba6b9f1004230756gf04316acq8519b375ce29e0d8@mail.gmail.com>
References: <6F57C2D1-8927-420C-940C-C6EC0C62AABE@gmail.com>	
	<4BD0DB9B.5050005@sonsorol.org>
	<l2o5cba6b9f1004230756gf04316acq8519b375ce29e0d8@mail.gmail.com>
Message-ID: <4BD1C05D.5010109@sonsorol.org>


In the last few months the open-bio.org servers switched datacenters, IP 
addresses and firewall/IDS appliances. Lots of juicy things to look at 
and debug.

Koen - if you have a chance can you send me the IP address that you are 
using to connect from? I might be able to find some relevant log entries 
with that info.

-Chris



Koen van der Drift wrote:
> Just for the record, it used to work with Transmit, this is only from
> the last few months.
>
> - Koen.
>
> On Thu, Apr 22, 2010 at 7:28 PM, Chris Dagdigian<dag at sonsorol.org>  wrote:
>> Might be an issue with the Juniper Netscreen firewall/IDS security appliance
>> that sits upstream of the EMBOSS FTP server. I'll take a look at the
>> security logs and alerts.
>>
>> -Chris
>>
>>
>> Koen van der Drift wrote:
>>> Hi,
>>>
>>> For a while now I am unable to access the emboss ftp site using the OS X
>>> client Transmit. Loggin in works fine, but it chokes on the LIST
>>> command. I have no problems accessing it from the command line. I have
>>> added the output from Transmit below. I don't know if this is a Transmit
>>> or emboss issue, but just wanted to let you know.
>>>
>>> Thanks,
>>>
>>> - Koen.
>>>
>>>
>>> Transmit 3.6.9 Session Transcript
>>> LibNcFTP 3.2.1 (August 13, 2007) compiled for UNIX
>>> Uname: Darwin|exile.local|9.8.0|Darwin Kernel Version 9.8.0: Wed Jul 15
>>> 16:57:01 PDT 2009; root:xnu-1228.15.4~1/RELEASE_PPC|Power Macintosh
>>> 220: (vsFTPd 2.0.1)
>>> Connected to emboss.open-bio.org.
>>> Cmd: USER anonymous
>>> 331: Please specify the password.
>>> Cmd: PASS NcFTP@
>>> 230: Login successful.
>>> Cmd: TYPE A
>>> 200: Switching to ASCII mode.
>>> Logged in to emboss.open-bio.org as anonymous.
>>> Cmd: SYST
>>> 215: UNIX Type: L8
>>> Cmd: PWD
>>> 257: "/"
>>> Cmd: CWD /pub/EMBOSS/fixes
>>> 250: Directory successfully changed.
>>> Cmd: PWD
>>> 257: "/pub/EMBOSS/fixes"
>>> Cmd: PASV
>>> 227: Entering Passive Mode (208,94,50,58,83,232)
>>> Cmd: LIST -a
>>> Could not read reply from control connection -- timed out. (SReadline 1)
>>> 220: (vsFTPd 2.0.1)
>>> Connected to emboss.open-bio.org.
>>> Cmd: USER anonymous
>>> 331: Please specify the password.
>>> Cmd: PASS NcFTP@
>>> 230: Login successful.
>>> Logged in to emboss.open-bio.org as anonymous.
>>> Cmd: SYST
>>> 215: UNIX Type: L8
>>> Cmd: PWD
>>> 257: "/"
>>> Cmd: CWD /pub/EMBOSS/fixes
>>> 250: Directory successfully changed.
>>> Cmd: PWD
>>> 257: "/pub/EMBOSS/fixes"
>>> Cmd: PASV
>>> 227: Entering Passive Mode (208,94,50,58,222,100)
>>> Cmd: LIST -a
>>> Could not read reply from control connection -- timed out. (SReadline 1)
>>>
>>> _______________________________________________
>>> EMBOSS mailing list
>>> EMBOSS at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/emboss


From asidhu at biomap.org  Mon Apr 26 05:35:13 2010
From: asidhu at biomap.org (Amandeep Sidhu)
Date: Mon, 26 Apr 2010 13:35:13 +0800
Subject: [EMBOSS] CFP: 23rd IEEE International Symposium on Computer-Based
	Medical Systems 2010
Message-ID: <CDBE908B-F041-41CE-B556-696E3C54B2BE@biomap.org>

IEEE CBMS 2010
23rd IEEE International Symposium on Computer-Based Medical Systems 2010
Perth, Australia, 12-15 October 2010

http://www.cbms2010.curtin.edu.au/

The 23rd IEEE International Symposium on Computer-Based Medical Systems (CBMS 2010) is intended to provide an international forum for discussing the latest results in the field of computational medicine. The scientific program of CBMS 2010 will consist of invited keynote talks given by leading scientists in the field, and regular and special track sessions that cover a broad array of issues which relate computing to medicine.

RELEVANT TOPICS

Network and Telemedicine Systems
Medical Databases & Information Systems
Computer-Aided Diagnosis
Medical Devices with Embedded Computers
Bioinformatics in Medicine
Software Systems in Medicine
Pervasive Health Systems and Services
Web-based Delivery of Medical Information
Medical Image Segmentation & Compression
Content Analysis of Biomedical Image Data
Knowledge-Based & Decision Support Systems
Hand-held Computing Applications in Medicine
Knowledge Discovery & Data Mining
Signal and Image Processing in Medicine
Multimedia Biomedical Databases

CBMS 2010 invites original previously unpublished contributions that are not submitted concurrently to a journal or another conference. Many of the above listed topics are represented by corresponding Special Tracks, while others are solely covered by the general CBMS track. Prospective authors are expected to submit their contributions to one of the corresponding Special Tracks or to the general track if none of the special tracks is relevant.

SPECIAL TRACKS

ST1: Computational Proteomics and Genomics
ST2: Knowledge Discovery and Decision Systems in Biomedicine
ST3: Ontologies for Biomedical Systems
ST4: HealthGrid & Cloud Computing
ST5: Technology Enhanced Learning in Medical Education
ST6: Intelligent Patient Management
ST7: Data Streams in Healthcare
ST8: Supporting Collaboration among Healthcare Workers
ST9: Telemedicine
ST10: Computer-Based Systems for Mental Health
ST11: Image Informatics in Biomedical Research and Clinical Medicine
ST12: e-Health

SUBMISSION GUIDELINES

Papers should be submitted electronically using EasyChair online submission system. The papers must be prepared following the IEEE two-column format and should not exceed the length of 6 (six) Letter-sized pages. LaTeX or Microsoft Word templates can be used when preparing the papers. Please, note that only PDF format of submissions is allowed.

Submission web site: http://www.easychair.org/conferences/?conf=cbms2010

All submissions will be peer-reviewed by at least three reviewers. The proceedings will be published by the IEEE Computer Society Press. At least one of the authors of accepted papers is required to register and present the work at the conference; otherwise their papers will be removed from the digital library after the conference.

IMPORTANT DATES

Submission deadline for regular papers:        		24 June 2010
Deadline for tutorial submission:                       24 June 2010
Notification of acceptation for papers and tutorials:    2 Aug 2010
Final camera ready due:                                  2 Sep 2010
Author registration:                                     2 Sep 2010

INTENDED AUDIENCE

Engineers, scientists, clinicians and managers involved in medical computing projects are encouraged to submit papers to the symposium and/or attend the symposium. The symposium provides its attendees with an opportunity to experience state-of-the-art research and development in a variety of topics directly and indirectly related to their own work. In addition to research papers, keynote speakers and tutorial sessions it provides participants with an opportunity to come up-to-date on important technological issues. The symposium encourages the participation of students engaged in research/development in computer-based medical systems.

Organizing Committee

GENERAL CHAIRS

Tharam Dillon, Curtin University of Technology, Australia
Daniel Rubin, National Center for Biomedical Ontologies, USA
William Gallagher, University College Dublin, Ireland

PROGRAM CHAIRS

Amandeep Sidhu, Curtin University of Technology, Australia
Alexey Tsymbal, Siemens, Germany

PUBLICATION CHAIRS

Mykola Pechenizkiy, Eindhoven University of Technology, Netherlands
Tony Hu, Drexel University, USA

SPECIAL TRACK CHAIRS

Maja Hadzic, Curtin University of Technology, Australia
Jake Chen, Indiana University, USA

TUTORIAL CHAIRS

Phoebe Chen, La Trobe University, Australia
Xiaofang Zhou, University of Queensland, Australia

PUBLICITY CHAIRS

Carolyn McGregor, University of Ontario Institute of Technology, Canada
Meifania Chen, Curtin University of Technology, Australia


From p.h.jones at liverpool.ac.uk  Mon Apr 26 12:47:44 2010
From: p.h.jones at liverpool.ac.uk (Philip H. Jones)
Date: Mon, 26 Apr 2010 13:47:44 +0100
Subject: [EMBOSS] Convert scf to fasta
Message-ID: <0D2BD44B-6881-48DA-BA12-8465A038A048@liverpool.ac.uk>

Hi

I have a large number of .scf files that I need to batch convert to  
fasta format. I thought that abiview would be able to perform this  
function but I cannot get abiview to read the .scf files (although  
various sources on the internet suggest that it should be able to do  
so). It reads and displays .ab1 files with no problems. The webpage  
describing input formats (http://emboss.sourceforge.net/docs/themes/SequenceFormats.html 
) doesn't mention scf. Is there an EMBOSS application that would  
convert .scf to .fa? Any help would be greatly appreciated. I am  
running Mac OSX 10.5.8 with EMBOSS 6.1.0-4 installed via fink.

Best wishes,

Phil Jones





From fernan.aguero at gmail.com  Mon Apr 26 13:29:10 2010
From: fernan.aguero at gmail.com (Fernan Aguero)
Date: Mon, 26 Apr 2010 10:29:10 -0300
Subject: [EMBOSS] Convert scf to fasta
In-Reply-To: <0D2BD44B-6881-48DA-BA12-8465A038A048@liverpool.ac.uk>
References: <0D2BD44B-6881-48DA-BA12-8465A038A048@liverpool.ac.uk>
Message-ID: <x2i520894aa1004260629xb09c8bccn2e2f10c1df3e7c7b@mail.gmail.com>

On Mon, Apr 26, 2010 at 9:47 AM, Philip H. Jones
<p.h.jones at liverpool.ac.uk> wrote:
> Hi
>
> I have a large number of .scf files that I need to batch convert to fasta
> format. I thought that abiview would be able to perform this function but I
> cannot get abiview to read the .scf files (although various sources on the
> internet suggest that it should be able to do so). It reads and displays
> .ab1 files with no problems. The webpage describing input formats
> (http://emboss.sourceforge.net/docs/themes/SequenceFormats.html) doesn't
> mention scf. Is there an EMBOSS application that would convert .scf to .fa?
> Any help would be greatly appreciated. I am running Mac OSX 10.5.8 with
> EMBOSS 6.1.0-4 installed via fink.
>
> Best wishes,
>
> Phil Jones

AFAIK, abiview reads trace files but it displays the trace and
sequence data _graphically_. That is to say it's not really meant to
be used for batch conversions.

For this you may want to try phred (free for academic use, see
www.phrap.org, runs on many Unix flavours) or any other basecaller
(don't use OS X myself, can't provide more info on this).

E.g. if you have all your scf files in a directory called 'chromats'
you would run phred like this:
phred -id chromats -sa my-sequences.fasta
to get a multiple fasta file named 'my-sequences.fasta' with the
corresponding sequences.

Note that you have many more options, as phred will also export/report
base quality values for your sequences.

Cheers,

-- 
fernan


From pmr at ebi.ac.uk  Mon Apr 26 14:10:44 2010
From: pmr at ebi.ac.uk (Peter Rice)
Date: Mon, 26 Apr 2010 15:10:44 +0100
Subject: [EMBOSS] Convert scf to fasta
In-Reply-To: <0D2BD44B-6881-48DA-BA12-8465A038A048@liverpool.ac.uk>
References: <0D2BD44B-6881-48DA-BA12-8465A038A048@liverpool.ac.uk>
Message-ID: <4BD59EE4.7030409@ebi.ac.uk>

Dear Phil,

On 26/04/2010 13:47, Philip H. Jones wrote:
> Hi
>
> I have a large number of .scf files that I need to batch convert to
> fasta format. I thought that abiview would be able to perform this
> function but I cannot get abiview to read the .scf files (although
> various sources on the internet suggest that it should be able to do
> so). It reads and displays .ab1 files with no problems. The webpage
> describing input formats
> (http://emboss.sourceforge.net/docs/themes/SequenceFormats.html) doesn't
> mention scf. Is there an EMBOSS application that would convert .scf to
> .fa? Any help would be greatly appreciated. I am running Mac OSX 10.5.8
> with EMBOSS 6.1.0-4 installed via fink.

We can read .abi files (we have some extensions for the next release to 
cover abi format in more detail).

I will pick up some scf files and check what the difference is. We have 
not tried them before.

Any other formats we can usefully cover?

regards,

Peter Rice


From gbottu at vub.ac.be  Mon Apr 26 15:28:46 2010
From: gbottu at vub.ac.be (Guy Bottu)
Date: Mon, 26 Apr 2010 17:28:46 +0200
Subject: [EMBOSS] Convert scf to fasta
In-Reply-To: <4BD59EE4.7030409@ebi.ac.uk>
References: <0D2BD44B-6881-48DA-BA12-8465A038A048@liverpool.ac.uk>
	<4BD59EE4.7030409@ebi.ac.uk>
Message-ID: <4BD5B12E.7010103@vub.ac.be>

Peter Rice wrote:
> Any other formats we can usefully cover?

The ZTR format (compressed version of SCF) designed by the Staden 
development team.

http://en.wikipedia.org/wiki/Staden_Package
http://www.be.embnet.org/stadenhelp/manual/formats_unix_toc.html

But how many people are still using it ? Maybe not worth the effort.

	Guy Bottu


From litd99 at gmail.com  Mon Apr 26 15:48:56 2010
From: litd99 at gmail.com (Tiandao Li)
Date: Mon, 26 Apr 2010 10:48:56 -0500
Subject: [EMBOSS] Convert scf to fasta
In-Reply-To: <x2i520894aa1004260629xb09c8bccn2e2f10c1df3e7c7b@mail.gmail.com>
References: <0D2BD44B-6881-48DA-BA12-8465A038A048@liverpool.ac.uk>
	<x2i520894aa1004260629xb09c8bccn2e2f10c1df3e7c7b@mail.gmail.com>
Message-ID: <v2l1ee6623e1004260848pbdd1e69eo30c7896327d2d946@mail.gmail.com>

Yes, definitely try phred/phrap/consed for base calling in batch mode, just
store all scf files in one folder, and google some help for it. the result
files include fasta files with quality scores, it is aonvient for downstream
analysis.

HTH.


http://www.phrap.org/phredphrapconsed.html


On Mon, Apr 26, 2010 at 8:29 AM, Fernan Aguero <fernan.aguero at gmail.com>wrote:

> On Mon, Apr 26, 2010 at 9:47 AM, Philip H. Jones
> <p.h.jones at liverpool.ac.uk> wrote:
> > Hi
> >
> > I have a large number of .scf files that I need to batch convert to fasta
> > format. I thought that abiview would be able to perform this function but
> I
> > cannot get abiview to read the .scf files (although various sources on
> the
> > internet suggest that it should be able to do so). It reads and displays
> > .ab1 files with no problems. The webpage describing input formats
> > (http://emboss.sourceforge.net/docs/themes/SequenceFormats.html) doesn't
> > mention scf. Is there an EMBOSS application that would convert .scf to
> .fa?
> > Any help would be greatly appreciated. I am running Mac OSX 10.5.8 with
> > EMBOSS 6.1.0-4 installed via fink.
> >
> > Best wishes,
> >
> > Phil Jones
>
> AFAIK, abiview reads trace files but it displays the trace and
> sequence data _graphically_. That is to say it's not really meant to
> be used for batch conversions.
>
> For this you may want to try phred (free for academic use, see
> www.phrap.org, runs on many Unix flavours) or any other basecaller
> (don't use OS X myself, can't provide more info on this).
>
> E.g. if you have all your scf files in a directory called 'chromats'
> you would run phred like this:
> phred -id chromats -sa my-sequences.fasta
> to get a multiple fasta file named 'my-sequences.fasta' with the
> corresponding sequences.
>
> Note that you have many more options, as phred will also export/report
> base quality values for your sequences.
>
> Cheers,
>
> --
> fernan
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss
>


From p.h.jones at liverpool.ac.uk  Mon Apr 26 16:03:37 2010
From: p.h.jones at liverpool.ac.uk (Philip H. Jones)
Date: Mon, 26 Apr 2010 17:03:37 +0100
Subject: [EMBOSS] Convert scf to fasta
In-Reply-To: <v2l1ee6623e1004260848pbdd1e69eo30c7896327d2d946@mail.gmail.com>
References: <0D2BD44B-6881-48DA-BA12-8465A038A048@liverpool.ac.uk>
	<x2i520894aa1004260629xb09c8bccn2e2f10c1df3e7c7b@mail.gmail.com>
	<v2l1ee6623e1004260848pbdd1e69eo30c7896327d2d946@mail.gmail.com>
Message-ID: <F6DC86C7-FC1B-4C48-A738-C7B2F0A3DDB2@liverpool.ac.uk>

Thanks very much for the replies. I've applied to get phred and will  
give that a try - sounds promising. I'll let you know how I get on.

Phil


From biopython at maubp.freeserve.co.uk  Mon Apr 26 16:39:40 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Mon, 26 Apr 2010 17:39:40 +0100
Subject: [EMBOSS] ABI to FASTQ with seqret
In-Reply-To: <4BD080F6.3060409@ebi.ac.uk>
References: <320fb6e01003300446g487fb954jdc94112224182772@mail.gmail.com>
	<4BB1F8F8.8050608@ebi.ac.uk> <4BB1FBE1.8030400@ebi.ac.uk>
	<320fb6e01003300656g6d9b5c28oe0f98f8deedbd484@mail.gmail.com>
	<i2i320fb6e01004220806m34bb1c66re9ae85df406c5f2a@mail.gmail.com>
	<4BD06999.2080502@ebi.ac.uk>
	<x2q320fb6e01004220848p386a567eg2a76d38689f8571f@mail.gmail.com>
	<4BD080F6.3060409@ebi.ac.uk>
Message-ID: <x2x320fb6e01004260939uf3141d8asfcc023dd5345bb3a@mail.gmail.com>

On Thu, Apr 22, 2010 at 6:01 PM, Peter Rice <pmr at ebi.ac.uk> wrote:
>> Does this mean there is an updated seqret in a public repository where I
>> can convert an ABI file to FASTQ taking the ABI basecaller's sequence
>> and PHRED scores? I'd be interested to test that... or a patch against
>> EMBOSS 6.2.0.
>
> It is in the latest CVS code and will appeart in the July release.

Thanks Peter,

I tried to grab this from the anonymous CVS mirror as per the EMBOSS
documentation here:
http://emboss.sourceforge.net/developers/cvs.html

Unfortunately it failed:

$ cvs -d :pserver:cvs at cvs.open-bio.org:/home/repository/emboss login
Logging in to :pserver:cvs at cvs.open-bio.org:2401/home/repository/emboss
CVS password:
cvs login: authorization failed: server cvs.open-bio.org rejected
access to /home/repository/emboss for user cvs

I know there have been VM problems on this machine (also known as
code.open-bio.org) which have been intermitently been affecting the
anonymous SVN access for other projects like BioPerl.

One short term solution would be to give my OBF username peterc
access to the master Emboss CVS repository on dev.open-bio.org
(joke), or look into an external mirror - for example BioPerl are using
github (and seriously talking about moving from SVN to git). This is
going even more off topic but since ViewCVS broke a while back, I've
found it much harder to browse the Emboss source code :(

Regards,

Peter C.


From n.celik00 at gmail.com  Tue Apr 27 03:13:08 2010
From: n.celik00 at gmail.com (Nermin Celik)
Date: Tue, 27 Apr 2010 13:13:08 +1000
Subject: [EMBOSS] Candidia
Message-ID: <v2q345d775d1004262013x1b3d1609v58618542394474b2@mail.gmail.com>

Hi,

I would like to translate yeast Candida albicans nucleotide sequence into
protein sequence using transeq. However I got confused with the '-table'
values.

The taxonomy information for candidia is:
*Lineage*<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=160764&lvl=3&lin=s&keep=1&srchmode=1&unlock>
(full): root<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Root&id=1&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
cellular organisms<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=131567&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Eukaryota<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=2759&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Fungi/Metazoa group<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=33154&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Metazoa<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=33208&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Eumetazoa<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=6072&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Bilateria<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=33213&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Coelomata<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=33316&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Deuterostomia<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=33511&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Chordata<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=7711&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Craniata<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=89593&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Vertebrata<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=7742&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Gnathostomata<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=7776&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Teleostomi<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=117570&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Euteleostomi<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=117571&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Actinopterygii<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=7898&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Actinopteri<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=186623&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Neopterygii<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=41665&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Teleostei<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=32443&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Elopocephala<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=186624&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Clupeocephala<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=186625&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Otocephala<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=186634&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Ostariophysi<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=32519&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Otophysi<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=186626&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Cypriniphysi<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=186627&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Cypriniformes<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=7952&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Cyprinoidea<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=30727&lvl=3&lin=f&keep=1&srchmode=1&unlock>;
Cyprinidae<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=7953&lvl=3&lin=f&keep=1&srchmode=1&unlock>

(retrieved from NCBI).

Based on the above information which '-table' value is best/suitable?

Nermin


From kiekyon.huang at gmail.com  Tue Apr 27 04:13:21 2010
From: kiekyon.huang at gmail.com (Kie Kyon Huang)
Date: Tue, 27 Apr 2010 12:13:21 +0800
Subject: [EMBOSS] extract sequence
Message-ID: <q2sa54400841004262113qad22f43dk9dff735b032bb5c8@mail.gmail.com>

Hi all

i need to extract a large number of sequences from the mouse genome.

I only have the location of the sequence,

I am wondering if emboss has any program to do this

Thanks


From gbottu at vub.ac.be  Tue Apr 27 16:02:40 2010
From: gbottu at vub.ac.be (Guy Bottu)
Date: Tue, 27 Apr 2010 18:02:40 +0200
Subject: [EMBOSS] question about XML manual
Message-ID: <4BD70AA0.2060509@vub.ac.be>

	Dear friends,

It is already some while that the EMBOSS staff started working on a new 
EMBOSS manual using the XMLmind software (and I contributed myself a 
part about wEMBOSS). Excuse me if I am asking a stupid question but I 
fail to find where the manual can be downloaded or consulted on-line.

	Regards,
	Guy Bottu


From jison at ebi.ac.uk  Tue Apr 27 16:30:23 2010
From: jison at ebi.ac.uk (Jon Ison)
Date: Tue, 27 Apr 2010 17:30:23 +0100 (BST)
Subject: [EMBOSS] question about XML manual
In-Reply-To: <4BD70AA0.2060509@vub.ac.be>
References: <4BD70AA0.2060509@vub.ac.be>
Message-ID: <33351.172.22.100.208.1272385823.squirrel@webmail.ebi.ac.uk>

Dear Guy and folks

For the time being, you can get the latest versions from my naff homepage:
http://www.ebi.ac.uk/~jison/

(in M$ word or HTML)

The versions there are not quite the final ones, but are not far off.  Soon, it'll all be moved to
a revamped EMBOSS website.  I'll make an announcement when that happens.

Cheers

Jon



> 	Dear friends,
>
> It is already some while that the EMBOSS staff started working on a new
> EMBOSS manual using the XMLmind software (and I contributed myself a
> part about wEMBOSS). Excuse me if I am asking a stupid question but I
> fail to find where the manual can be downloaded or consulted on-line.
>
> 	Regards,
> 	Guy Bottu
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss
>




From georgios at biotek.uio.no  Tue Apr 27 16:27:55 2010
From: georgios at biotek.uio.no (Georgios Magklaras)
Date: Tue, 27 Apr 2010 18:27:55 +0200
Subject: [EMBOSS] question about XML manual
In-Reply-To: <4BD70AA0.2060509@vub.ac.be>
References: <4BD70AA0.2060509@vub.ac.be>
Message-ID: <4BD7108B.5080607@biotek.uio.no>

I second that query.

GM

On 04/27/2010 06:02 PM, Guy Bottu wrote:
>     Dear friends,
>
> It is already some while that the EMBOSS staff started working on a 
> new EMBOSS manual using the XMLmind software (and I contributed myself 
> a part about wEMBOSS). Excuse me if I am asking a stupid question but 
> I fail to find where the manual can be downloaded or consulted on-line.
>
>     Regards,
>     Guy Bottu
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss


-- 
Best regards,
--

George Magklaras BSc (Hons) MPhil RHCE
IT Systems Manager/Senior Systems Engineer
The Biotechnology Center of Oslo
University of Oslo

http://www.biotek.uio.no
http://www.no.embnet.org
http://folk.uio.no/georgios




From michael.watson at bbsrc.ac.uk  Wed Apr 28 10:39:29 2010
From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C))
Date: Wed, 28 Apr 2010 11:39:29 +0100
Subject: [EMBOSS] Files needed for JASPEXTRACT
Message-ID: <8D08960C647E64438CE5740657CBBDC50236BBA349@iahcexch1.iah.bbsrc.ac.uk>

Hi

Hopefully I'm not missing anything obvious, but the doc for jaspextract states:

"The input files are the uncompressed and extracted JASPAR_CORE.tgz, JASPAR_FAM.tgz and JASPAR_PHYLOFACTS.tgz files provided in the JASPAR MatrixDir download directory of the JASPAR homepage"

I've had a look and can't find these files in the downloads section of http://jaspar.genereg.net/.

Is there somewhere else I need to look?

Mick





From simon.andrews at bbsrc.ac.uk  Wed Apr 28 11:07:14 2010
From: simon.andrews at bbsrc.ac.uk (simon andrews (BI))
Date: Wed, 28 Apr 2010 12:07:14 +0100
Subject: [EMBOSS] Files needed for JASPEXTRACT
In-Reply-To: <8D08960C647E64438CE5740657CBBDC50236BBA349@iahcexch1.iah.bbsrc.ac.uk>
References: <8D08960C647E64438CE5740657CBBDC50236BBA349@iahcexch1.iah.bbsrc.ac.uk>
Message-ID: <6884418F-3AAF-4821-B51C-5C76CE3C5E07@bbsrc.ac.uk>

Mick,

I asked this about a month ago and got a helpful answer...

http://www.mail-archive.com/emboss at lists.open-bio.org/msg01373.html

Simon.


On 28 Apr 2010, at 11:39, michael watson (IAH-C) wrote:

> Hi
> 
> Hopefully I'm not missing anything obvious, but the doc for jaspextract states:
> 
> "The input files are the uncompressed and extracted JASPAR_CORE.tgz, JASPAR_FAM.tgz and JASPAR_PHYLOFACTS.tgz files provided in the JASPAR MatrixDir download directory of the JASPAR homepage"
> 
> I've had a look and can't find these files in the downloads section of http://jaspar.genereg.net/.
> 
> Is there somewhere else I need to look?
> 
> Mick
> 
> 
> 
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss