[EMBOSS] Conservation of FASTQ scores by the EMBOSS tools.

[Mahmut Uludag]

Hi Charles,

seqret returns quality scores if the input sequence format is explicitly
defined on the command line, such as -sformat=fastq-sanger.

The following patch looks like fixes the vectorstrip problem.


*** ajseq.c.org	2009-09-16 10:08:17.000000000 +0100
--- ajseq.c	2009-09-16 09:52:56.000000000 +0100
***************
*** 781,786 ****
--- 781,792 ----
  
      if (seq->Fttable)
  	pthis->Fttable = ajFeattableCopy(seq->Fttable);
+     
+     if (seq->Accuracy)
+     {
+     	AJCNEW0(pthis->Accuracy,seq->Seq->Len);
+
memmove(pthis->Accuracy,seq->Accuracy,seq->Seq->Len*sizeof(float));
+     }
  
      return pthis;
  }


Regards,
Mahmut


> I have multi-sequence file in FASTQ format that contains sequencing reads, and
> would like to retreive them the with seqret. But as you see in the following
> example, quality scores are not preserved:
> 
> $ seqret P13-CA.fq:F1EZY7316JY25B fastq::stdout
> Reads and writes (returns) sequences
> @F1EZY7316JY25B rank=0000040 x=3973.0 y=285.0 length=68
> AATGATACGGCGACCACCGAACACTGCGTTTGCTGGCTTTGATGCACTTCTCATGGCCAATTTCATTG
> +
> """"""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""
> 
> The purpose was to use seqret as a workaround for the fact that vectorstrip
> does not keep the quality either.
> 
> Do you think that it would be possible to get this functionality as a patch in
> the future, or is it big work that needs to wait for the next release?