From mathog at caltech.edu Sun Nov 1 17:21:58 2009 From: mathog at caltech.edu (David Mathog) Date: Sun, 01 Nov 2009 14:21:58 -0800 Subject: [EMBOSS] installation verification - automatic detection of missing "cores" for wrappers Message-ID: It would be _really_ helpful if there was some sort of: make test_wrappers or make find_empty_wrappers which could be run after make install which would show which emboss programs that are just wrappers are missing the core program that they enable. In random testing I keep running into new programs on the web menu (W2H or EMBOSS-Explorer) which blow up when tested because the "real" program isn't present. The latest, was elipop, which does not work without lipoP. No way to tell from the names what is a wrapper, and what isn't. epestfind is a program, elipop is a wrapper. Then searching in the build directory it turns out that elipop is part of cbstools, and I knew from an earlier case like this that these are mostly (all?) wrappers. Thanks, David Mathog mathog at caltech.edu Manager, Sequence Analysis Facility, Biology Division, Caltech From Richard.Rothery at UAlberta.ca Tue Nov 3 15:04:13 2009 From: Richard.Rothery at UAlberta.ca (Richard Rothery) Date: Tue, 3 Nov 2009 13:04:13 -0700 Subject: [EMBOSS] Emboss explorer does not show manual pages running under Ubuntu 9.10..... Message-ID: I am unable to display manual pages for emboss-explorer running under Ubuntu 9.10. This worked as a great reference under 9.04, but no longer works. I have tried reinstalling emboss via synaptic (this is where I got the program from). The machine was updated from 9.04 to 9.10 rather than being bulldozed and reinstalled. I hope someone can help with this! Sincerely, Richard A. Rothery, Ph.D. Research Associate ______________________________________________ Membrane Protein Research Group, Department of Biochemistry, University of Alberta, Edmonton T6G 2H7 Ph. 780-492-2229 Fax. 780-492-0886 ______________________________________________ From charles-listes-emboss at plessy.org Wed Nov 4 08:59:00 2009 From: charles-listes-emboss at plessy.org (charles-listes-emboss at plessy.org) Date: Wed, 4 Nov 2009 22:59:00 +0900 Subject: [EMBOSS] Emboss explorer does not show manual pages running under Ubuntu 9.10..... In-Reply-To: References: Message-ID: <20091104135900.GD6611@kunpuu.plessy.org> Le Tue, Nov 03, 2009 at 01:04:13PM -0700, Richard Rothery a ?crit : > I am unable to display manual pages for emboss-explorer running under Ubuntu > 9.10. This worked as a great reference under 9.04, but no longer works. Dear Richard, I found the problem: tfm -html does not work with the latest packages of EMBOSS on Debian, and therefore most probably Ubuntu. EMBOSS-Explorer relies on this command to generate the manual pages. More precisely, ?tfm? looks in ?/usr/share/EMBOSS/doc/programs/text/?, but ?tfm -html? looks in ?/usr/share/doc/programs/html/?. It is probably a bug that I introduced in the packages I created for Debian and Ubuntu. I built them with ?$(MAKE) AJAX_FIXED_ROOT=\\\"/usr/share/EMBOSS\\\"?, does anybody know what other variable I forgot to set to indicate a proper path to the HTML documentation? Have a nice day, -- Charles Plessy Debian Med packaging team, http://www.debian.org/devel/debian-med Tsurumi, Kanagawa, Japan From Richard.Rothery at UAlberta.ca Wed Nov 4 10:06:29 2009 From: Richard.Rothery at UAlberta.ca (Richard Rothery) Date: Wed, 4 Nov 2009 08:06:29 -0700 Subject: [EMBOSS] Jemboss under Ubuntu 9.10..... Message-ID: Hi, I downloaded jemboss (and emboss, obviously) from synaptic under Ubuntu 9.10. The files download and the install script seems to run normally, but the jemboss-packaged emboss commands do not show up under the menu system "a la" bio-Linux. Is there an easy way to fix this or to complete the install? Thanks, Richard Rothery ______________________________________________ Membrane Protein Research Group, Department of Biochemistry, University of Alberta, Edmonton T6G 2H7 Ph. 780-492-2229 Fax. 780-492-0886 ______________________________________________ From charles-listes-emboss at plessy.org Thu Nov 5 01:26:04 2009 From: charles-listes-emboss at plessy.org (charles-listes-emboss at plessy.org) Date: Thu, 5 Nov 2009 15:26:04 +0900 Subject: [EMBOSS] Jemboss under Ubuntu 9.10..... In-Reply-To: References: Message-ID: <20091105062604.GE9400@kunpuu.plessy.org> Le Wed, Nov 04, 2009 at 08:06:29AM -0700, Richard Rothery a ?crit : > > I downloaded jemboss (and emboss, obviously) from synaptic under Ubuntu > 9.10. The files download and the install script seems to run normally, but > the jemboss-packaged emboss commands do not show up under the menu system "a > la" bio-Linux. Is there an easy way to fix this or to complete the install? Dear Richard and EMBOSS developers, it is very easy to have jEmboss to appear in the Applications menu of the most recent desktop environments, in particular Gnome, KDE and Xfce. For a system-wide effect, you need to copy the attached jemboss.desktop file in /usr/share/applications. (The menu may not be refreshed automagically). As a local user on Gnome desktop, you just need to copy this file on the Desktop, right-click on the Applications menu and chose ?Edit menus?, and then drag and drop the jemboss.desktop file where you would like it to be seen. The next update of the Debian/Ubuntu package will contain this file and do what is necessary. One thing however is that in these menus, it does not look good if there is not a nice icon, and I do not have one for jEmboss. If the jEmboss developers could send one to me and distribute it in their next release, that would be appreciated. If there is no icon ready, maybe a subscriber of this list with graphics skills could contribute one? SVG format is preferred, and should look nice when converted to 32?32, 48?48 and 64?64 pixels. Does anybody has the sources of the gif files in jemboss/images ? Have a nice day, -- Charles Plessy Debian Med packaging team, http://www.debian.org/devel/debian-med Tsurumi, Kanagawa, Japan From charles-listes-emboss at plessy.org Thu Nov 5 01:33:06 2009 From: charles-listes-emboss at plessy.org (charles-listes-emboss at plessy.org) Date: Thu, 5 Nov 2009 15:33:06 +0900 Subject: [EMBOSS] Jemboss under Ubuntu 9.10..... In-Reply-To: <20091105062604.GE9400@kunpuu.plessy.org> References: <20091105062604.GE9400@kunpuu.plessy.org> Message-ID: <20091105063306.GF9400@kunpuu.plessy.org> Le Thu, Nov 05, 2009 at 03:26:04PM +0900, charles-listes-emboss at plessy.org a ?crit : > > it is very easy to have jEmboss to appear in the Applications menu of the most > recent desktop environments, in particular Gnome, KDE and Xfce. For a > system-wide effect, you need to copy the attached jemboss.desktop file in > /usr/share/applications. (The menu may not be refreshed automagically). As a > local user on Gnome desktop, you just need to copy this file on the Desktop, > right-click on the Applications menu and chose ?Edit menus?, and then drag and > drop the jemboss.desktop file where you would like it to be seen. The next > update of the Debian/Ubuntu package will contain this file and do what is > necessary. Apologises for the noise, here is the file I pretented to attach in the previous message? -- Charles -------------- next part -------------- [Desktop Entry] Version=1.0 Terminal=false Icon=jemboss Exec=runJemboss.csh Name=jEmboss GenericName=GUI for EMBOSS Comment=Graphical user interface for the European Molecular Biology Open Software Suite. Type=Application Categories=Biology;Science;Education; From jeedward at yahoo.com Sun Nov 8 18:53:50 2009 From: jeedward at yahoo.com (John Edward) Date: Sun, 8 Nov 2009 15:53:50 -0800 (PST) Subject: [EMBOSS] BCBGC-10 Call for papers Message-ID: <815932.744.qm@web45909.mail.sp1.yahoo.com> BCBGC-10 Call for papers ? The 2010 International Conference on Bioinformatics, Computational Biology, Genomics and Chemoinformatics (BCBGC-10) (website: http://www.PromoteResearch.org) will be held during 12-14 of July 2010 in Orlando, FL, USA. ?BCBGC is an important event in the areas of bioinformatics, computational biology, genomics and chemoinformatics and focuses on all areas related to the conference. ? The conference will be held at the same time and location where several other major international conferences will be taking place. The conference will be held as part of 2010 multi-conference (MULTICONF-10). MULTICONF-10 will be held during July 12-14, 2010 in Orlando, Florida, USA. The primary goal of MULTICONF is to promote research and developmental activities in computer science, information technology, control engineering, and related fields. Another goal is to promote the dissemination of research to a multidisciplinary audience and to facilitate communication among researchers, developers, practitioners in different fields. The following conferences are planned to be organized as part of MULTICONF-10. ? International Conference on Artificial Intelligence and Pattern Recognition (AIPR-10) ?International Conference on Automation, Robotics and Control Systems (ARCS-10) International Conference on Bioinformatics, Computational Biology, Genomics and Chemoinformatics (BCBGC-10) International Conference on Computer Networks (CN-10) International Conference on Enterprise Information Systems and Web Technologies (EISWT-10) International Conference on High Performance Computing Systems (HPCS-10) International Conference on Information Security and Privacy (ISP-10) International Conference on Image and Video Processing and Computer Vision (IVPCV-10) International Conference on Software Engineering Theory and Practice (SETP-10) International Conference on Theoretical and Mathematical Foundations of Computer Science (TMFCS-10) ? We invite draft paper submissions. Please see the website http://www.PromoteResearch.org for more details. ? Sincerely John Edward Publicity committee From ap12 at sanger.ac.uk Thu Nov 12 12:34:41 2009 From: ap12 at sanger.ac.uk (Anne Pajon) Date: Thu, 12 Nov 2009 17:34:41 +0000 Subject: [EMBOSS] extractfeat problem with complement() in CDS Message-ID: <0D93616D-018B-4DF7-A493-9B825399BA77@sanger.ac.uk> Dear, I have an embl file containing these lines FT CDS complement(2232788..2233492) FT /systematic_id="SARLGA251_20000" when I use extractfeat -sequence embl::LGA251_reduced.embl -type CDS on emboss version 6.1, the output contains these lines for the corresponding CDS: >SARLGA251_2232788_2233492 [CDS] t and on emboss version 6.0, the output contains these lines: >SARLGA251_2232788_2233492 [CDS] atggctagtgttttatatcaacatggtacattaggcacattaatggcaggtttattaaaa ggaactgcatcaataaatgaattattgcaacatggtgatttaggtatcgctacactaaca ggttcaaatggtgaggtcatctttttagatggaaaagcctatcatgcaaatgaacataaa gaatttgtggaattaaaaggtgatgagttaacaccatatgcaactgtaactaaatttgta gcagatacaagctatgaaacgaaagataaatcttctgaagcagtttttgcagaaattaag gaaaagatgttgagtgaaaatttattttctgcagtaaaaatttcaggtgtgtttaaaaaa atgcatgtacgtatgatgccggcacaagagccaccttatacacgtttaattgattcagct agaagacaacctgaacaaactgaaacatacgtcaaaggttcagtcgttgggttctttaca ccagaactattccatggtatcgggtcagcaggattccatgtacactttgcaaatgatgat cgtaactttggtggacatgtcttagattttgaagtagaagatgttaaggtagaaatccaa aatatagaaacatttgaacagcattttccaattcaagatgaagatttcataaatgcaaat attgactataaagatattgcagacgaaattagagaagctgaataa Does anyone know why it is not extracting the correct sequence for the CDS features with the latest version of emboss? I am running it on Mac OSX and I've installed it with fink. Thanks in advance for your help. Kind regards, Anne. -- Dr Anne Pajon - Pathogen Genomics Sanger Institute, Wellcome Trust Genome Campus, Hinxton Cambridge CB10 1SA, United Kingdom +44 (0)1223 494 798 (office) | +44 (0)7958 511 353 (mobile) -- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in England with number 1021457 and a company registered in England with number 2742969, whose registered office is 215 Euston Road, London, NW1 2BE. From pmr at ebi.ac.uk Thu Nov 12 13:29:54 2009 From: pmr at ebi.ac.uk (Peter Rice) Date: Thu, 12 Nov 2009 18:29:54 +0000 Subject: [EMBOSS] extractfeat problem with complement() in CDS In-Reply-To: <0D93616D-018B-4DF7-A493-9B825399BA77@sanger.ac.uk> References: <0D93616D-018B-4DF7-A493-9B825399BA77@sanger.ac.uk> Message-ID: <4AFC5422.500@ebi.ac.uk> Dear Anne, Anne Pajon wrote: > extractfeat -sequence embl::LGA251_reduced.embl -type CDS > > Does anyone know why it is not extracting the correct sequence for the > CDS features with the latest version of emboss? I am running it on Mac > OSX and I've installed it with fink. This is a bug. We have a partial fix, but need a little more testing to make sure it fixes all cases. regards, Peter Rice From ap12 at sanger.ac.uk Fri Nov 13 05:14:54 2009 From: ap12 at sanger.ac.uk (Anne Pajon) Date: Fri, 13 Nov 2009 10:14:54 +0000 Subject: [EMBOSS] extractfeat problem with complement() in CDS In-Reply-To: <4AFC5422.500@ebi.ac.uk> References: <0D93616D-018B-4DF7-A493-9B825399BA77@sanger.ac.uk> <4AFC5422.500@ebi.ac.uk> Message-ID: Dear Peter, Thanks for your answer. Let me know when a fix is available for testing. Would your advice be for the time being to use the version 6.0.1-4 instead of 6.1.0-3? Thanks to let me know. Kind regards, Anne. On 12 Nov 2009, at 18:29, Peter Rice wrote: > Dear Anne, > > Anne Pajon wrote: > >> extractfeat -sequence embl::LGA251_reduced.embl -type CDS >> Does anyone know why it is not extracting the correct sequence for >> the CDS features with the latest version of emboss? I am running it >> on Mac OSX and I've installed it with fink. > > This is a bug. We have a partial fix, but need a little more testing > to make sure it fixes all cases. > > regards, > > Peter Rice -- Dr Anne Pajon - Pathogen Genomics Sanger Institute, Wellcome Trust Genome Campus, Hinxton Cambridge CB10 1SA, United Kingdom +44 (0)1223 494 798 (office) | +44 (0)7958 511 353 (mobile) -- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in England with number 1021457 and a company registered in England with number 2742969, whose registered office is 215 Euston Road, London, NW1 2BE. From zen.lu at roslin.ed.ac.uk Tue Nov 24 12:16:07 2009 From: zen.lu at roslin.ed.ac.uk (zen lu (RI)) Date: Tue, 24 Nov 2009 17:16:07 +0000 Subject: [EMBOSS] extractseq Message-ID: <050C9A545DC1D84BAC7A678B76A56C3C251E21A32E@ebrcexch1.ebrc.bbsrc.ac.uk> Dear EMBOSS Users, Is it possible to use extractseq to extract multiple regions from a multi-fasta file according the headers? Thank you. Cheers, ZL From david.bauer at bayerhealthcare.com Wed Nov 25 02:04:45 2009 From: david.bauer at bayerhealthcare.com (david.bauer at bayerhealthcare.com) Date: Wed, 25 Nov 2009 08:04:45 +0100 Subject: [EMBOSS] Antwort: extractseq In-Reply-To: <050C9A545DC1D84BAC7A678B76A56C3C251E21A32E@ebrcexch1.ebrc.bbsrc.ac.uk> Message-ID: Hi ZL, the input for extracseq is 'sequence' and not 'seqall' so it works only on a single sequence. You could use something like this to loop through your multiple fasta file (the example returns the first 30 bases of each of 3 sequences contained in test.fa). perl -e 'for($I=0;$I<3;$I++){$seq = `skipseq test.fa -skip $I | seqret -filter -firstonly | extractseq -filter -region 1-30`; print $seq}' Cheers, David. emboss-bounces at lists.open-bio.org schrieb am 11/24/2009 06:16:07 PM: > Dear EMBOSS Users, > > Is it possible to use extractseq to extract multiple regions from a > multi-fasta file according the headers? Thank you. > > Cheers, > ZL > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss From biopython at maubp.freeserve.co.uk Thu Nov 26 11:02:50 2009 From: biopython at maubp.freeserve.co.uk (Peter) Date: Thu, 26 Nov 2009 16:02:50 +0000 Subject: [EMBOSS] Fwd: [DAS] DAS workshop 7th-9th April 2010 In-Reply-To: References: Message-ID: <320fb6e00911260802wb98b28fic8a193c125e29d9c@mail.gmail.com> This might be of interest to some of you. Peter ---------- Forwarded message ---------- From: Jonathan Warren Date: Thu, Nov 26, 2009 at 2:57 PM Subject: [DAS] DAS workshop 7th-9th April 2010 To: das at biodas.org, das_registry_announce at sanger.ac.uk, biojava-dev , BioJava , BioPerl , all at sanger.ac.uk, all at ebi.ac.uk, ensembldev We are considering running a Distributed Annotation System workshop here at the Sanger/EBI in the UK subject to decent demand. The workshop will be held from Wednesday 7th-Friday 9th April 2010. If you would be interested in attending either to present or just take part then please email me jw12 at sanger.ac.uk The format of the workshop is likely to be similar to last years (1st day for beginners, 2nd for both beginners and advanced users, 3rd day for advanced), information for which can be found here: http://www.dasregistry.org/course.jsp If you would like to present then please send a short summary of what you would like to talk about. Thanks Jonathan. Jonathan Warren Senior Developer and DAS coordinator jw12 at sanger.ac.uk -- The Wellcome Trust Sanger Institute is operated by Genome ResearchLimited, a charity registered in England with number 1021457 and acompany registered in England with number 2742969, whose registeredoffice is 215 Euston Road, London, NW1 2BE._______________________________________________ DAS mailing list DAS at lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/das From mathog at caltech.edu Sun Nov 1 22:21:58 2009 From: mathog at caltech.edu (David Mathog) Date: Sun, 01 Nov 2009 14:21:58 -0800 Subject: [EMBOSS] installation verification - automatic detection of missing "cores" for wrappers Message-ID: It would be _really_ helpful if there was some sort of: make test_wrappers or make find_empty_wrappers which could be run after make install which would show which emboss programs that are just wrappers are missing the core program that they enable. In random testing I keep running into new programs on the web menu (W2H or EMBOSS-Explorer) which blow up when tested because the "real" program isn't present. The latest, was elipop, which does not work without lipoP. No way to tell from the names what is a wrapper, and what isn't. epestfind is a program, elipop is a wrapper. Then searching in the build directory it turns out that elipop is part of cbstools, and I knew from an earlier case like this that these are mostly (all?) wrappers. Thanks, David Mathog mathog at caltech.edu Manager, Sequence Analysis Facility, Biology Division, Caltech From Richard.Rothery at UAlberta.ca Tue Nov 3 20:04:13 2009 From: Richard.Rothery at UAlberta.ca (Richard Rothery) Date: Tue, 3 Nov 2009 13:04:13 -0700 Subject: [EMBOSS] Emboss explorer does not show manual pages running under Ubuntu 9.10..... Message-ID: I am unable to display manual pages for emboss-explorer running under Ubuntu 9.10. This worked as a great reference under 9.04, but no longer works. I have tried reinstalling emboss via synaptic (this is where I got the program from). The machine was updated from 9.04 to 9.10 rather than being bulldozed and reinstalled. I hope someone can help with this! Sincerely, Richard A. Rothery, Ph.D. Research Associate ______________________________________________ Membrane Protein Research Group, Department of Biochemistry, University of Alberta, Edmonton T6G 2H7 Ph. 780-492-2229 Fax. 780-492-0886 ______________________________________________ From charles-listes-emboss at plessy.org Wed Nov 4 13:59:00 2009 From: charles-listes-emboss at plessy.org (charles-listes-emboss at plessy.org) Date: Wed, 4 Nov 2009 22:59:00 +0900 Subject: [EMBOSS] Emboss explorer does not show manual pages running under Ubuntu 9.10..... In-Reply-To: References: Message-ID: <20091104135900.GD6611@kunpuu.plessy.org> Le Tue, Nov 03, 2009 at 01:04:13PM -0700, Richard Rothery a ?crit : > I am unable to display manual pages for emboss-explorer running under Ubuntu > 9.10. This worked as a great reference under 9.04, but no longer works. Dear Richard, I found the problem: tfm -html does not work with the latest packages of EMBOSS on Debian, and therefore most probably Ubuntu. EMBOSS-Explorer relies on this command to generate the manual pages. More precisely, ?tfm? looks in ?/usr/share/EMBOSS/doc/programs/text/?, but ?tfm -html? looks in ?/usr/share/doc/programs/html/?. It is probably a bug that I introduced in the packages I created for Debian and Ubuntu. I built them with ?$(MAKE) AJAX_FIXED_ROOT=\\\"/usr/share/EMBOSS\\\"?, does anybody know what other variable I forgot to set to indicate a proper path to the HTML documentation? Have a nice day, -- Charles Plessy Debian Med packaging team, http://www.debian.org/devel/debian-med Tsurumi, Kanagawa, Japan From Richard.Rothery at UAlberta.ca Wed Nov 4 15:06:29 2009 From: Richard.Rothery at UAlberta.ca (Richard Rothery) Date: Wed, 4 Nov 2009 08:06:29 -0700 Subject: [EMBOSS] Jemboss under Ubuntu 9.10..... Message-ID: Hi, I downloaded jemboss (and emboss, obviously) from synaptic under Ubuntu 9.10. The files download and the install script seems to run normally, but the jemboss-packaged emboss commands do not show up under the menu system "a la" bio-Linux. Is there an easy way to fix this or to complete the install? Thanks, Richard Rothery ______________________________________________ Membrane Protein Research Group, Department of Biochemistry, University of Alberta, Edmonton T6G 2H7 Ph. 780-492-2229 Fax. 780-492-0886 ______________________________________________ From charles-listes-emboss at plessy.org Thu Nov 5 06:26:04 2009 From: charles-listes-emboss at plessy.org (charles-listes-emboss at plessy.org) Date: Thu, 5 Nov 2009 15:26:04 +0900 Subject: [EMBOSS] Jemboss under Ubuntu 9.10..... In-Reply-To: References: Message-ID: <20091105062604.GE9400@kunpuu.plessy.org> Le Wed, Nov 04, 2009 at 08:06:29AM -0700, Richard Rothery a ?crit : > > I downloaded jemboss (and emboss, obviously) from synaptic under Ubuntu > 9.10. The files download and the install script seems to run normally, but > the jemboss-packaged emboss commands do not show up under the menu system "a > la" bio-Linux. Is there an easy way to fix this or to complete the install? Dear Richard and EMBOSS developers, it is very easy to have jEmboss to appear in the Applications menu of the most recent desktop environments, in particular Gnome, KDE and Xfce. For a system-wide effect, you need to copy the attached jemboss.desktop file in /usr/share/applications. (The menu may not be refreshed automagically). As a local user on Gnome desktop, you just need to copy this file on the Desktop, right-click on the Applications menu and chose ?Edit menus?, and then drag and drop the jemboss.desktop file where you would like it to be seen. The next update of the Debian/Ubuntu package will contain this file and do what is necessary. One thing however is that in these menus, it does not look good if there is not a nice icon, and I do not have one for jEmboss. If the jEmboss developers could send one to me and distribute it in their next release, that would be appreciated. If there is no icon ready, maybe a subscriber of this list with graphics skills could contribute one? SVG format is preferred, and should look nice when converted to 32?32, 48?48 and 64?64 pixels. Does anybody has the sources of the gif files in jemboss/images ? Have a nice day, -- Charles Plessy Debian Med packaging team, http://www.debian.org/devel/debian-med Tsurumi, Kanagawa, Japan From charles-listes-emboss at plessy.org Thu Nov 5 06:33:06 2009 From: charles-listes-emboss at plessy.org (charles-listes-emboss at plessy.org) Date: Thu, 5 Nov 2009 15:33:06 +0900 Subject: [EMBOSS] Jemboss under Ubuntu 9.10..... In-Reply-To: <20091105062604.GE9400@kunpuu.plessy.org> References: <20091105062604.GE9400@kunpuu.plessy.org> Message-ID: <20091105063306.GF9400@kunpuu.plessy.org> Le Thu, Nov 05, 2009 at 03:26:04PM +0900, charles-listes-emboss at plessy.org a ?crit : > > it is very easy to have jEmboss to appear in the Applications menu of the most > recent desktop environments, in particular Gnome, KDE and Xfce. For a > system-wide effect, you need to copy the attached jemboss.desktop file in > /usr/share/applications. (The menu may not be refreshed automagically). As a > local user on Gnome desktop, you just need to copy this file on the Desktop, > right-click on the Applications menu and chose ?Edit menus?, and then drag and > drop the jemboss.desktop file where you would like it to be seen. The next > update of the Debian/Ubuntu package will contain this file and do what is > necessary. Apologises for the noise, here is the file I pretented to attach in the previous message? -- Charles -------------- next part -------------- [Desktop Entry] Version=1.0 Terminal=false Icon=jemboss Exec=runJemboss.csh Name=jEmboss GenericName=GUI for EMBOSS Comment=Graphical user interface for the European Molecular Biology Open Software Suite. Type=Application Categories=Biology;Science;Education; From jeedward at yahoo.com Sun Nov 8 23:53:50 2009 From: jeedward at yahoo.com (John Edward) Date: Sun, 8 Nov 2009 15:53:50 -0800 (PST) Subject: [EMBOSS] BCBGC-10 Call for papers Message-ID: <815932.744.qm@web45909.mail.sp1.yahoo.com> BCBGC-10 Call for papers ? The 2010 International Conference on Bioinformatics, Computational Biology, Genomics and Chemoinformatics (BCBGC-10) (website: http://www.PromoteResearch.org) will be held during 12-14 of July 2010 in Orlando, FL, USA. ?BCBGC is an important event in the areas of bioinformatics, computational biology, genomics and chemoinformatics and focuses on all areas related to the conference. ? The conference will be held at the same time and location where several other major international conferences will be taking place. The conference will be held as part of 2010 multi-conference (MULTICONF-10). MULTICONF-10 will be held during July 12-14, 2010 in Orlando, Florida, USA. The primary goal of MULTICONF is to promote research and developmental activities in computer science, information technology, control engineering, and related fields. Another goal is to promote the dissemination of research to a multidisciplinary audience and to facilitate communication among researchers, developers, practitioners in different fields. The following conferences are planned to be organized as part of MULTICONF-10. ? International Conference on Artificial Intelligence and Pattern Recognition (AIPR-10) ?International Conference on Automation, Robotics and Control Systems (ARCS-10) International Conference on Bioinformatics, Computational Biology, Genomics and Chemoinformatics (BCBGC-10) International Conference on Computer Networks (CN-10) International Conference on Enterprise Information Systems and Web Technologies (EISWT-10) International Conference on High Performance Computing Systems (HPCS-10) International Conference on Information Security and Privacy (ISP-10) International Conference on Image and Video Processing and Computer Vision (IVPCV-10) International Conference on Software Engineering Theory and Practice (SETP-10) International Conference on Theoretical and Mathematical Foundations of Computer Science (TMFCS-10) ? We invite draft paper submissions. Please see the website http://www.PromoteResearch.org for more details. ? Sincerely John Edward Publicity committee From ap12 at sanger.ac.uk Thu Nov 12 17:34:41 2009 From: ap12 at sanger.ac.uk (Anne Pajon) Date: Thu, 12 Nov 2009 17:34:41 +0000 Subject: [EMBOSS] extractfeat problem with complement() in CDS Message-ID: <0D93616D-018B-4DF7-A493-9B825399BA77@sanger.ac.uk> Dear, I have an embl file containing these lines FT CDS complement(2232788..2233492) FT /systematic_id="SARLGA251_20000" when I use extractfeat -sequence embl::LGA251_reduced.embl -type CDS on emboss version 6.1, the output contains these lines for the corresponding CDS: >SARLGA251_2232788_2233492 [CDS] t and on emboss version 6.0, the output contains these lines: >SARLGA251_2232788_2233492 [CDS] atggctagtgttttatatcaacatggtacattaggcacattaatggcaggtttattaaaa ggaactgcatcaataaatgaattattgcaacatggtgatttaggtatcgctacactaaca ggttcaaatggtgaggtcatctttttagatggaaaagcctatcatgcaaatgaacataaa gaatttgtggaattaaaaggtgatgagttaacaccatatgcaactgtaactaaatttgta gcagatacaagctatgaaacgaaagataaatcttctgaagcagtttttgcagaaattaag gaaaagatgttgagtgaaaatttattttctgcagtaaaaatttcaggtgtgtttaaaaaa atgcatgtacgtatgatgccggcacaagagccaccttatacacgtttaattgattcagct agaagacaacctgaacaaactgaaacatacgtcaaaggttcagtcgttgggttctttaca ccagaactattccatggtatcgggtcagcaggattccatgtacactttgcaaatgatgat cgtaactttggtggacatgtcttagattttgaagtagaagatgttaaggtagaaatccaa aatatagaaacatttgaacagcattttccaattcaagatgaagatttcataaatgcaaat attgactataaagatattgcagacgaaattagagaagctgaataa Does anyone know why it is not extracting the correct sequence for the CDS features with the latest version of emboss? I am running it on Mac OSX and I've installed it with fink. Thanks in advance for your help. Kind regards, Anne. -- Dr Anne Pajon - Pathogen Genomics Sanger Institute, Wellcome Trust Genome Campus, Hinxton Cambridge CB10 1SA, United Kingdom +44 (0)1223 494 798 (office) | +44 (0)7958 511 353 (mobile) -- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in England with number 1021457 and a company registered in England with number 2742969, whose registered office is 215 Euston Road, London, NW1 2BE. From pmr at ebi.ac.uk Thu Nov 12 18:29:54 2009 From: pmr at ebi.ac.uk (Peter Rice) Date: Thu, 12 Nov 2009 18:29:54 +0000 Subject: [EMBOSS] extractfeat problem with complement() in CDS In-Reply-To: <0D93616D-018B-4DF7-A493-9B825399BA77@sanger.ac.uk> References: <0D93616D-018B-4DF7-A493-9B825399BA77@sanger.ac.uk> Message-ID: <4AFC5422.500@ebi.ac.uk> Dear Anne, Anne Pajon wrote: > extractfeat -sequence embl::LGA251_reduced.embl -type CDS > > Does anyone know why it is not extracting the correct sequence for the > CDS features with the latest version of emboss? I am running it on Mac > OSX and I've installed it with fink. This is a bug. We have a partial fix, but need a little more testing to make sure it fixes all cases. regards, Peter Rice From ap12 at sanger.ac.uk Fri Nov 13 10:14:54 2009 From: ap12 at sanger.ac.uk (Anne Pajon) Date: Fri, 13 Nov 2009 10:14:54 +0000 Subject: [EMBOSS] extractfeat problem with complement() in CDS In-Reply-To: <4AFC5422.500@ebi.ac.uk> References: <0D93616D-018B-4DF7-A493-9B825399BA77@sanger.ac.uk> <4AFC5422.500@ebi.ac.uk> Message-ID: Dear Peter, Thanks for your answer. Let me know when a fix is available for testing. Would your advice be for the time being to use the version 6.0.1-4 instead of 6.1.0-3? Thanks to let me know. Kind regards, Anne. On 12 Nov 2009, at 18:29, Peter Rice wrote: > Dear Anne, > > Anne Pajon wrote: > >> extractfeat -sequence embl::LGA251_reduced.embl -type CDS >> Does anyone know why it is not extracting the correct sequence for >> the CDS features with the latest version of emboss? I am running it >> on Mac OSX and I've installed it with fink. > > This is a bug. We have a partial fix, but need a little more testing > to make sure it fixes all cases. > > regards, > > Peter Rice -- Dr Anne Pajon - Pathogen Genomics Sanger Institute, Wellcome Trust Genome Campus, Hinxton Cambridge CB10 1SA, United Kingdom +44 (0)1223 494 798 (office) | +44 (0)7958 511 353 (mobile) -- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in England with number 1021457 and a company registered in England with number 2742969, whose registered office is 215 Euston Road, London, NW1 2BE. From zen.lu at roslin.ed.ac.uk Tue Nov 24 17:16:07 2009 From: zen.lu at roslin.ed.ac.uk (zen lu (RI)) Date: Tue, 24 Nov 2009 17:16:07 +0000 Subject: [EMBOSS] extractseq Message-ID: <050C9A545DC1D84BAC7A678B76A56C3C251E21A32E@ebrcexch1.ebrc.bbsrc.ac.uk> Dear EMBOSS Users, Is it possible to use extractseq to extract multiple regions from a multi-fasta file according the headers? Thank you. Cheers, ZL From david.bauer at bayerhealthcare.com Wed Nov 25 07:04:45 2009 From: david.bauer at bayerhealthcare.com (david.bauer at bayerhealthcare.com) Date: Wed, 25 Nov 2009 08:04:45 +0100 Subject: [EMBOSS] Antwort: extractseq In-Reply-To: <050C9A545DC1D84BAC7A678B76A56C3C251E21A32E@ebrcexch1.ebrc.bbsrc.ac.uk> Message-ID: Hi ZL, the input for extracseq is 'sequence' and not 'seqall' so it works only on a single sequence. You could use something like this to loop through your multiple fasta file (the example returns the first 30 bases of each of 3 sequences contained in test.fa). perl -e 'for($I=0;$I<3;$I++){$seq = `skipseq test.fa -skip $I | seqret -filter -firstonly | extractseq -filter -region 1-30`; print $seq}' Cheers, David. emboss-bounces at lists.open-bio.org schrieb am 11/24/2009 06:16:07 PM: > Dear EMBOSS Users, > > Is it possible to use extractseq to extract multiple regions from a > multi-fasta file according the headers? Thank you. > > Cheers, > ZL > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss From biopython at maubp.freeserve.co.uk Thu Nov 26 16:02:50 2009 From: biopython at maubp.freeserve.co.uk (Peter) Date: Thu, 26 Nov 2009 16:02:50 +0000 Subject: [EMBOSS] Fwd: [DAS] DAS workshop 7th-9th April 2010 In-Reply-To: References: Message-ID: <320fb6e00911260802wb98b28fic8a193c125e29d9c@mail.gmail.com> This might be of interest to some of you. Peter ---------- Forwarded message ---------- From: Jonathan Warren Date: Thu, Nov 26, 2009 at 2:57 PM Subject: [DAS] DAS workshop 7th-9th April 2010 To: das at biodas.org, das_registry_announce at sanger.ac.uk, biojava-dev , BioJava , BioPerl , all at sanger.ac.uk, all at ebi.ac.uk, ensembldev We are considering running a Distributed Annotation System workshop here at the Sanger/EBI in the UK subject to decent demand. The workshop will be held from Wednesday 7th-Friday 9th April 2010. If you would be interested in attending either to present or just take part then please email me jw12 at sanger.ac.uk The format of the workshop is likely to be similar to last years (1st day for beginners, 2nd for both beginners and advanced users, 3rd day for advanced), information for which can be found here: http://www.dasregistry.org/course.jsp If you would like to present then please send a short summary of what you would like to talk about. Thanks Jonathan. Jonathan Warren Senior Developer and DAS coordinator jw12 at sanger.ac.uk -- The Wellcome Trust Sanger Institute is operated by Genome ResearchLimited, a charity registered in England with number 1021457 and acompany registered in England with number 2742969, whose registeredoffice is 215 Euston Road, London, NW1 2BE._______________________________________________ DAS mailing list DAS at lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/das