From michael.watson at bbsrc.ac.uk  Tue Dec  1 09:33:23 2009
From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C))
Date: Tue, 1 Dec 2009 14:33:23 +0000
Subject: [EMBOSS] Trimming illumina short reads based on quality
Message-ID: <8D08960C647E64438CE5740657CBBDC50148732064@iahcexch1.iah.bbsrc.ac.uk>

Hi

I'm sorry if I've not been keeping up to date on what is doubtless a hot topic.

Does EMBOSS allow one to trim short reads based on quality data (from a fastq file)?

If not, I have read that it is planned - any idea when it will be implemented?

Otherwise, alternative suggestions are welcome!

Thanks
Mick



From golharam at umdnj.edu  Tue Dec  1 10:46:20 2009
From: golharam at umdnj.edu (Ryan Golhar)
Date: Tue, 01 Dec 2009 10:46:20 -0500
Subject: [EMBOSS] Trimming illumina short reads based on quality
In-Reply-To: <8D08960C647E64438CE5740657CBBDC50148732064@iahcexch1.iah.bbsrc.ac.uk>
References: <8D08960C647E64438CE5740657CBBDC50148732064@iahcexch1.iah.bbsrc.ac.uk>
Message-ID: <4B153A4C.6000904@umdnj.edu>

Michael,

Doesn't Illumina provide tools to do this?  I know with ABI Solid data, 
they have a perl script capable of trimming data based on quality scores.

Ryan


michael watson (IAH-C) wrote:
> Hi
> 
> I'm sorry if I've not been keeping up to date on what is doubtless a hot topic.
> 
> Does EMBOSS allow one to trim short reads based on quality data (from a fastq file)?
> 
> If not, I have read that it is planned - any idea when it will be implemented?
> 
> Otherwise, alternative suggestions are welcome!
> 
> Thanks
> Mick
> 
> 
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss
> 

From d.m.a.martin at dundee.ac.uk  Tue Dec  1 11:16:21 2009
From: d.m.a.martin at dundee.ac.uk (David Martin)
Date: Tue, 01 Dec 2009 16:16:21 +0000
Subject: [EMBOSS] Trimming illumina short reads based on quality
In-Reply-To: <4B153A4C.6000904@umdnj.edu>
References: <8D08960C647E64438CE5740657CBBDC50148732064@iahcexch1.iah.bbsrc.ac.uk>
	<4B153A4C.6000904@umdnj.edu>
Message-ID: <4B154155.6F09.00E0.1@dundee.ac.uk>

>>> On 12/1/2009 at  3:46 PM, in message <4B153A4C.6000904 at umdnj.edu>, Ryan Golhar <golharam at umdnj.edu> wrote:
I think virtually every man and his dog who has done anything with Illumina reads has a variety of perl scripts that do this. It depends how you want to do the trimming. Do you want to clip to a specific length, clip on quality (absolute or average over a window) and do you have a minimum length requirement? 

Do you want to clip 3' and 5' ends or just one? 

..d 


Michael,

Doesn't Illumina provide tools to do this?  I know with ABI Solid data,
they have a perl script capable of trimming data based on quality scores.

Ryan


michael watson (IAH-C) wrote:
> Hi
>
> I'm sorry if I've not been keeping up to date on what is doubtless a hot topic.
>
> Does EMBOSS allow one to trim short reads based on quality data (from a fastq file)?
>
> If not, I have read that it is planned - any idea when it will be implemented?
>
> Otherwise, alternative suggestions are welcome!
> 



David Martin PhD
College of Life Sciences
University of Dundee 
The University of Dundee is a Scottish Registered Charity, No. SC015096.


The University of Dundee is a registered Scottish charity, No: SC015096


From matthias.dodt at mdc-berlin.de  Tue Dec  1 11:17:48 2009
From: matthias.dodt at mdc-berlin.de (Matthias Dodt)
Date: Tue, 01 Dec 2009 17:17:48 +0100
Subject: [EMBOSS] using sixpack
Message-ID: <4B1541AC.8000301@mdc-berlin.de>

Hi there!

I have some problems using sixpack for 6-frame translation. I want to 
convert a fasta file of contigs with sixpack. The command is:

sixpack contigs.fa -outseq protein_sequence

The problem is that sixpack only converts the first sequence in the 
fasta file. How can i force it to process the whole file??

thanks!

greetings

mat


From ztu at msi.umn.edu  Tue Dec  1 13:38:54 2009
From: ztu at msi.umn.edu (Zheng Jin Tu)
Date: Tue, 1 Dec 2009 12:38:54 -0600 (CST)
Subject: [EMBOSS] Trimming illumina short reads based on quality
In-Reply-To: <4B154155.6F09.00E0.1@dundee.ac.uk>
References: <8D08960C647E64438CE5740657CBBDC50148732064@iahcexch1.iah.bbsrc.ac.uk>
	<4B153A4C.6000904@umdnj.edu> <4B154155.6F09.00E0.1@dundee.ac.uk>
Message-ID: <Pine.LNX.4.63.0912011223350.16025@l11.msi.umn.edu>


Need to find bioinformatician to do the coding.

Not sure how to set correct filter parameters
but just sharing some experiences:

Basically person will check both sequence string and quality 
string from xxx_qseq.txt file.  Match each nucleotide and quality
in char level:

454, qual 20 is 95% and 40 99% confident if I am correct.

In GA, qual score is bit coded and can be 
read out by ord function in perl:
   
 qualcore = ord( quality_char ) - 64;

Not sure the cut off appropriate value. B is quality score 2.  
Thus at least we remove these BBBBB.  May set another min length filter 
to get rid of less than like 10 nucleotides read after 
trimming for low quality score.

Set another one max_score or avg_score filter, like 5, it can 
filter out the third and forth sequences in below lines.

R0174436        1       8       119     0       1418    0       1       
.GATCTTCTCCTTCACCTCCTCCAGGTCCTTGGTCAGCTCAGCACGCAGAG     
Bb^`bb____bbaaVI_Zbbaba`X_bb`aUbbb`W\\a^\bbT[_Xb]__     0
R0174436        1       8       119     0       991     0       1       
.GCCAATCTGTACTTGTCTTCTTCAGTTCCCACTTTGAATACCGCACAGTC     
BaGT]]bb[]`_]abaIaaaVbb^``abbaM`Ubbb`babaQT]XS_[a[B     0
R0174436        1       8       119     1791    1559    0       1       
A..................................................     
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB     0
R0174436        1       8       119     1791    1997    0       1       
A..................................................     
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB     0

Some people also look for trimming down poly T in RNA-seq
case. But not sure how many TTTT should be out. Or also
do AAAA case for reverse case?

Finally better output to fastq file format.

@R0174436:6:83:0:1815#0/1
.GTCAATGCGTTCCACCCCCTCTGGGTAGCCTCCAACATCATGTACGTCGA
+R0174436:6:83:0:1815#0/1
Ba`babbb]bb\Xb]b___V^^aaaa___Z_\_[aaa]babb`X`^b\bbb
@R0174436:6:83:0:506#0/1
.GCAGGAGAAGCATTTTATCTTTGTATTTTCTTCACTGGCAACAACAATGT
+R0174436:6:83:0:506#0/1
BaOW_\I]__a``a_\_J_HU_V_J\a`aa^bab^^]]]Y]^`[`[T]]\^

Good luck.

TU

===================================================

On Tue, 1 Dec 2009, David Martin wrote:

> >>> On 12/1/2009 at  3:46 PM, in message <4B153A4C.6000904 at umdnj.edu>, Ryan Golhar <golharam at umdnj.edu> wrote:
> I think virtually every man and his dog who has done anything with Illumina reads has a variety of perl scripts that do this. It depends how you want to do the trimming. Do you want to clip to a specific length, clip on quality (absolute or average over a window) and do you have a minimum length requirement? 
> 
> Do you want to clip 3' and 5' ends or just one? 
> 
> ..d 
> 
> 
> Michael,
> 
> Doesn't Illumina provide tools to do this?  I know with ABI Solid data,
> they have a perl script capable of trimming data based on quality scores.
> 
> Ryan
> 
> 
> michael watson (IAH-C) wrote:
> > Hi
> >
> > I'm sorry if I've not been keeping up to date on what is doubtless a hot topic.
> >
> > Does EMBOSS allow one to trim short reads based on quality data (from a fastq file)?
> >
> > If not, I have read that it is planned - any idea when it will be implemented?
> >
> > Otherwise, alternative suggestions are welcome!
> > 
> 
> 
> 
> David Martin PhD
> College of Life Sciences
> University of Dundee 
> The University of Dundee is a Scottish Registered Charity, No. SC015096.
> 
> 
> The University of Dundee is a registered Scottish charity, No: SC015096
> 
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss
> 


From biopython at maubp.freeserve.co.uk  Tue Dec  1 14:45:58 2009
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Tue, 1 Dec 2009 19:45:58 +0000
Subject: [EMBOSS] Trimming illumina short reads based on quality
In-Reply-To: <8D08960C647E64438CE5740657CBBDC50148732064@iahcexch1.iah.bbsrc.ac.uk>
References: <8D08960C647E64438CE5740657CBBDC50148732064@iahcexch1.iah.bbsrc.ac.uk>
Message-ID: <320fb6e00912011145i2111042ap222cd8fdaef0364b@mail.gmail.com>

On Tue, Dec 1, 2009 at 2:33 PM, michael watson (IAH-C)
<michael.watson at bbsrc.ac.uk> wrote:
>
> Hi
>
> I'm sorry if I've not been keeping up to date on what is doubtless a hot topic.
>
> Does EMBOSS allow one to trim short reads based on quality data (from a fastq file)?
>
> If not, I have read that it is planned - any idea when it will be implemented?

Not yet, but it has been proposed and I understand it is on the
EMBOSS to do list along with quality filtering (Peter Rice has
suggested the name quaffle for this):
http://lists.open-bio.org/pipermail/bioperl-l/2009-July/030493.html

I dare say suggestions for precise trimming algorithms (e.g. median
over sliding window) might be welcome.

> Otherwise, alternative suggestions are welcome!

I'm sure there are plenty of scripts out these, in Perl, Python etc.
What is your language of choice?

Peter C.

From zen.lu at roslin.ed.ac.uk  Tue Dec  1 15:15:46 2009
From: zen.lu at roslin.ed.ac.uk (zen lu (RI))
Date: Tue, 1 Dec 2009 20:15:46 +0000
Subject: [EMBOSS] Trimming illumina short reads based on quality
In-Reply-To: <8D08960C647E64438CE5740657CBBDC50148732064@iahcexch1.iah.bbsrc.ac.uk>
References: <8D08960C647E64438CE5740657CBBDC50148732064@iahcexch1.iah.bbsrc.ac.uk>
Message-ID: <050C9A545DC1D84BAC7A678B76A56C3C251E351D24@ebrcexch1.ebrc.bbsrc.ac.uk>

The fastx-toolkit may be what you are looking for:
http://hannonlab.cshl.edu/fastx_toolkit/
________________________________________
From: emboss-bounces at lists.open-bio.org [emboss-bounces at lists.open-bio.org] On Behalf Of michael watson (IAH-C) [michael.watson at bbsrc.ac.uk]
Sent: 01 December 2009 14:33
To: emboss at lists.open-bio.org
Subject: [EMBOSS] Trimming illumina short reads based on quality

Hi

I'm sorry if I've not been keeping up to date on what is doubtless a hot topic.

Does EMBOSS allow one to trim short reads based on quality data (from a fastq file)?

If not, I have read that it is planned - any idea when it will be implemented?

Otherwise, alternative suggestions are welcome!

Thanks
Mick


_______________________________________________
EMBOSS mailing list
EMBOSS at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/emboss


From pmr at ebi.ac.uk  Wed Dec  2 04:43:42 2009
From: pmr at ebi.ac.uk (Peter Rice)
Date: Wed, 02 Dec 2009 09:43:42 +0000
Subject: [EMBOSS] using sixpack
In-Reply-To: <4B1541AC.8000301@mdc-berlin.de>
References: <4B1541AC.8000301@mdc-berlin.de>
Message-ID: <4B1636CE.6050403@ebi.ac.uk>

On 12/01/2009 04:17 PM, Matthias Dodt wrote:
> Hi there!
>
> I have some problems using sixpack for 6-frame translation. I want to
> convert a fasta file of contigs with sixpack. The command is:
>
> sixpack contigs.fa -outseq protein_sequence
>
> The problem is that sixpack only converts the first sequence in the
> fasta file. How can i force it to process the whole file??

Two options:

One is to change the EMBOSS code to loop over each sequence.

The other is to write a script that extracts each sequence in turn and
launches sixpack.

We can consider this for the next EMBOSS release. It applies to other
applications too. In general, would users (and developers of web and
other interfaces) be happy if more applications could read every
sequence in a fasta file?

This raises questions of how to mark up the output so that it is clear
where each results comes from. There will always be applications where
it is more sensible to proces sonly a single sequence.

A third option (there is so often another way):

getorf will find and report open reading frames in all input sequences

getorf contigs.fa -outseq protein_sequence

There will be differences in the output - getorf limits ORFs to 30
nucleotides. You get the same effect in sixpack with -orfmin 10 (oops,
sixpack counts amino acids - we will try to make them consistent in the
next release!)

You can also add -minsize 3 to the getorf command line to report all
ORFs like sixpack does.

Hope this helps,

Peter Rice

From matthias.dodt at mdc-berlin.de  Thu Dec  3 04:39:43 2009
From: matthias.dodt at mdc-berlin.de (Matthias Dodt)
Date: Thu, 03 Dec 2009 10:39:43 +0100
Subject: [EMBOSS] using sixpack
In-Reply-To: <4B1636CE.6050403@ebi.ac.uk>
References: <4B1541AC.8000301@mdc-berlin.de> <4B1636CE.6050403@ebi.ac.uk>
Message-ID: <4B17875F.80803@mdc-berlin.de>

Hello Peter!

Thank you very much, getorf is sufficient for me-

greetings

mat

Peter Rice schrieb:
> On 12/01/2009 04:17 PM, Matthias Dodt wrote:
>> Hi there!
>>
>> I have some problems using sixpack for 6-frame translation. I want to
>> convert a fasta file of contigs with sixpack. The command is:
>>
>> sixpack contigs.fa -outseq protein_sequence
>>
>> The problem is that sixpack only converts the first sequence in the
>> fasta file. How can i force it to process the whole file??
>
> Two options:
>
> One is to change the EMBOSS code to loop over each sequence.
>
> The other is to write a script that extracts each sequence in turn and
> launches sixpack.
>
> We can consider this for the next EMBOSS release. It applies to other
> applications too. In general, would users (and developers of web and
> other interfaces) be happy if more applications could read every
> sequence in a fasta file?
>
> This raises questions of how to mark up the output so that it is clear
> where each results comes from. There will always be applications where
> it is more sensible to proces sonly a single sequence.
>
> A third option (there is so often another way):
>
> getorf will find and report open reading frames in all input sequences
>
> getorf contigs.fa -outseq protein_sequence
>
> There will be differences in the output - getorf limits ORFs to 30
> nucleotides. You get the same effect in sixpack with -orfmin 10 (oops,
> sixpack counts amino acids - we will try to make them consistent in the
> next release!)
>
> You can also add -minsize 3 to the getorf command line to report all
> ORFs like sixpack does.
>
> Hope this helps,
>
> Peter Rice

-- 
------------------------------------------------
Matthias Dodt

Scientific Programmer at Bioinformatics platform AG Dieterich

Berlin Institute for Medical Systems Biology at the
Max-Delbrueck-Center for Molecular Medicine
Robert-Roessle-Strasse 10, 13125 Berlin, Germany

fon: +49 30 9406 4261
email: matthias.dodt at mdc-berlin.de


From biopython at maubp.freeserve.co.uk  Mon Dec  7 14:36:30 2009
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Mon, 7 Dec 2009 19:36:30 +0000
Subject: [EMBOSS] Unknown output format 'refseqp' and 'genpept'
In-Reply-To: <mailman.23123.1260214251.2696.emboss@lists.open-bio.org>
References: <mailman.23123.1260214251.2696.emboss@lists.open-bio.org>
Message-ID: <320fb6e00912071136i26de9cadx9da04e1527999345@mail.gmail.com>

Hi,

I have a protein IntelliGenetics file used in the Biopython test suite:
http://biopython.org/SRC/biopython/Tests/IntelliGenetics/VIF_mase-pro.txt

I am using EMBOSS 6.1.0 (patch level 2 I think), and I am trying
to turn this into a "GenBank Protein File", or GenPept file, using
EMBOSS seqret.

EMBOSS can read the file fine, this works:
$ seqret -auto -sformat=ig -osformat=fasta VIF_mase-pro.txt temp.txt

Giving FASTA output with 16 gapped protein sequences, which is
good - although the ID of the first record is a bit odd.

Using "genbank" as the output format in EMBOSS seems to
mean nucleotide and not protein:

$ seqret -auto -sformat=ig -osformat=genbank VIF_mase-pro.txt temp.txt
Error: Sequence format 'genbank' not supported for protein sequences
Error: Sequence format 'genbank' not supported for protein sequences
...
Error: Sequence format 'genbank' not supported for protein sequences

Referring to the documentation,
http://emboss.sourceforge.net/docs/themes/SequenceFormats.html
I then tried "genpept" and "refseqp":

$ seqret -auto -sformat=ig -osformat=genpept VIF_mase-pro.txt temp.txt
Error: Unknown output format 'genpept'
Error: Unknown output format 'genpept'
...
Error: unknown output format 'genpept'

$ seqret -auto -sformat=ig -osformat=refseqp VIF_mase-pro.txt temp.txt
Error: Unknown output format 'refseqp'
Error: Unknown output format 'refseqp'
...
Error: unknown output format 'refseqp'

Doesn't EMBOSS seqret support genpept/refseqp as an output format?

Thanks,

Peter C.

From pmr at ebi.ac.uk  Tue Dec  8 08:32:41 2009
From: pmr at ebi.ac.uk (Peter Rice)
Date: Tue, 08 Dec 2009 13:32:41 +0000
Subject: [EMBOSS] Unknown output format 'refseqp' and 'genpept'
In-Reply-To: <320fb6e00912071136i26de9cadx9da04e1527999345@mail.gmail.com>
References: <mailman.23123.1260214251.2696.emboss@lists.open-bio.org>
	<320fb6e00912071136i26de9cadx9da04e1527999345@mail.gmail.com>
Message-ID: <4B1E5579.2070407@ebi.ac.uk>

Peter wrote:
> Hi,
> 
> I have a protein IntelliGenetics file used in the Biopython test suite:
> http://biopython.org/SRC/biopython/Tests/IntelliGenetics/VIF_mase-pro.txt
> 
> I am using EMBOSS 6.1.0 (patch level 2 I think), and I am trying
> to turn this into a "GenBank Protein File", or GenPept file, using
> EMBOSS seqret.
>
> Doesn't EMBOSS seqret support genpept/refseqp as an output format?

Oddly enough you are the first to ask for it.

Does biopython have a definition of the fields it expects to write out 
in a GenPept or RefseqP format file? We would be able to allow GenBank 
as an alias for, presumably, genpept.

Might be a good time to merge the format names and details from 
biopython and emboss. Where can Ifine the biopython ones?

regards,

Peter

From biopython at maubp.freeserve.co.uk  Tue Dec  8 08:53:13 2009
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Tue, 8 Dec 2009 13:53:13 +0000
Subject: [EMBOSS] Unknown output format 'refseqp' and 'genpept'
In-Reply-To: <4B1E5579.2070407@ebi.ac.uk>
References: <mailman.23123.1260214251.2696.emboss@lists.open-bio.org>
	<320fb6e00912071136i26de9cadx9da04e1527999345@mail.gmail.com>
	<4B1E5579.2070407@ebi.ac.uk>
Message-ID: <320fb6e00912080553w490f66vffab00edbe192069@mail.gmail.com>

On Tue, Dec 8, 2009 at 1:32 PM, Peter Rice <pmr at ebi.ac.uk> wrote:
>
> Peter wrote:
>>
>> Hi,
>>
>> I have a protein IntelliGenetics file used in the Biopython test suite:
>> http://biopython.org/SRC/biopython/Tests/IntelliGenetics/VIF_mase-pro.txt

It probably doesn't matter what the input file is here, the fact that
it was an (obsolete) format like IntelliGenetics was just chance as
I was working on a Biopython unit test.

>> I am using EMBOSS 6.1.0 (patch level 2 I think), and I am trying
>> to turn this into a "GenBank Protein File", or GenPept file, using
>> EMBOSS seqret.
>>
>> Doesn't EMBOSS seqret support genpept/refseqp as an output format?
>
> Oddly enough you are the first to ask for it.

That surprises me a little bit.

Could I suggest you treat known input formats which are not supported
as output formats a little differently and instead of this:

unknown output format 'genpept'

Perhaps give,

format 'genpept' is not supported for output (only input)

This would help the user rule out having a typo etc.

> Does biopython have a definition of the fields it expects to write out in a
> GenPept or RefseqP format file? We would be able to allow GenBank as an
> alias for, presumably, genpept.

Not explicitly, no. I was hoping to use EMBOSS for cross validation ;)

With hindsight this may have been a mistake, but we use "genbank"
format to mean either nucleotides of proteins. On parsing we just
look at the units of length in the LOCUS line (bp or aa). We also
try to cope with both the current NCBI files and some older variants
we have in our unit tests (different offsets in the LOCUS line).

> Might be a good time to merge the format names and details from biopython
> and emboss. Where can Ifine the biopython ones?

There are two tables on the wiki which include version information:
http://biopython.org/wiki/SeqIO
http://biopython.org/wiki/AlignIO

You can also consult the built in documentation, also available online:
http://biopython.org/DIST/docs/api/Bio.SeqIO-module.html
http://biopython.org/DIST/docs/api/Bio.AlignIO-module.html

For a long time I avoided having aliases (multiple names for the same
thing). However, we now treat "gb" as an alias for "genbank" (since
this is what the NCBI use in Entrez). We also treat "fastq-sanger" and
"fastq" the same.

Peter C (the one at Biopython)

From pmr at ebi.ac.uk  Tue Dec  8 09:11:59 2009
From: pmr at ebi.ac.uk (Peter Rice)
Date: Tue, 08 Dec 2009 14:11:59 +0000
Subject: [EMBOSS] Unknown output format 'refseqp' and 'genpept'
In-Reply-To: <320fb6e00912080553w490f66vffab00edbe192069@mail.gmail.com>
References: <mailman.23123.1260214251.2696.emboss@lists.open-bio.org>	
	<320fb6e00912071136i26de9cadx9da04e1527999345@mail.gmail.com>	
	<4B1E5579.2070407@ebi.ac.uk>
	<320fb6e00912080553w490f66vffab00edbe192069@mail.gmail.com>
Message-ID: <4B1E5EAF.80301@ebi.ac.uk>

Peter C. wrote:
> Could I suggest you treat known input formats which are not supported
> as output formats a little differently and instead of this:
> 
> unknown output format 'genpept'
> 
> Perhaps give,
> 
> format 'genpept' is not supported for output (only input)
> 
> This would help the user rule out having a typo etc.

A useful suggestion. We can apply that to feature formats too. I'll see 
what I can do.

may be worth a tidy up on what we do with formats that are only valid 
for nucleotide or protein (though that is a little tricky as we 
currently try to let some fail over to an equivalent format.

>> Does biopython have a definition of the fields it expects to write out in a
>> GenPept or RefseqP format file? We would be able to allow GenBank as an
>> alias for, presumably, genpept.
> 
> Not explicitly, no. I was hoping to use EMBOSS for cross validation ;)

No problem. We'll go first then and try to define standard formats.

> With hindsight this may have been a mistake, but we use "genbank"
> format to mean either nucleotides of proteins. On parsing we just
> look at the units of length in the LOCUS line (bp or aa). We also
> try to cope with both the current NCBI files and some older variants
> we have in our unit tests (different offsets in the LOCUS line).

We try that too on input, but for output we have to be explicit so the 
user can pick just one of the choices.

regards,

Peter R.

From biopython at maubp.freeserve.co.uk  Tue Dec  8 09:29:25 2009
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Tue, 8 Dec 2009 14:29:25 +0000
Subject: [EMBOSS] Unknown output format 'refseqp' and 'genpept'
In-Reply-To: <4B1E5EAF.80301@ebi.ac.uk>
References: <mailman.23123.1260214251.2696.emboss@lists.open-bio.org>
	<320fb6e00912071136i26de9cadx9da04e1527999345@mail.gmail.com>
	<4B1E5579.2070407@ebi.ac.uk>
	<320fb6e00912080553w490f66vffab00edbe192069@mail.gmail.com>
	<4B1E5EAF.80301@ebi.ac.uk>
Message-ID: <320fb6e00912080629h969fc27m46dc0165ff1832d0@mail.gmail.com>

On Tue, Dec 8, 2009 at 2:11 PM, Peter Rice <pmr at ebi.ac.uk> wrote:
>
>> With hindsight this may have been a mistake, but we use "genbank"
>> format to mean either nucleotides of proteins. On parsing we just
>> look at the units of length in the LOCUS line (bp or aa). We also
>> try to cope with both the current NCBI files and some older variants
>> we have in our unit tests (different offsets in the LOCUS line).
>
> We try that too on input, but for output we have to be explicit so the user
> can pick just one of the choices.

I imagine that as with Biopython, sometimes the user has made it
explicit that they are dealing with nucleotides or proteins (lots of
the EMBOSS tools have switches for this), so you know if you
should be using "aa" or "bp" in the LOCUS line.

Peter

From kellert at ohsu.edu  Tue Dec  8 15:13:36 2009
From: kellert at ohsu.edu (Tom Keller)
Date: Tue, 8 Dec 2009 12:13:36 -0800
Subject: [EMBOSS] newbie emma (clustalw) question
Message-ID: <A678B499-9B4F-42CA-8EB4-935C29F9ECA0@ohsu.edu>

This is an ongoing frustration. I use EMBOSS only occasionally, and I can never find a good guide for setting environmental variables. For example, I wanted to use emma with a new install of clustalw2. I made a link to it in /usr/local/bin, but emma can't find it. How do I fix this in a easy to maintain manner? 

thanks,
Tom


Thomas (Tom) Keller
kellert at ohsu.edu
503.494.2442
6339b R Jones Hall (BSc/CROET)
www.ohsu.edu/xd/research/research-cores/dna-analysis/



From kellert at ohsu.edu  Tue Dec  8 16:08:54 2009
From: kellert at ohsu.edu (Tom Keller)
Date: Tue, 8 Dec 2009 13:08:54 -0800
Subject: [EMBOSS] newbie emma (clustalw) question
In-Reply-To: <A678B499-9B4F-42CA-8EB4-935C29F9ECA0@ohsu.edu>
References: <A678B499-9B4F-42CA-8EB4-935C29F9ECA0@ohsu.edu>
Message-ID: <3A1B51FF-D28D-43DE-A555-E6B6D3163352@ohsu.edu>

I finally found the answer. It's simple, but if you don't know it, your only guessing, and that is really not a good approach. 
The environmental variable to set is EMBOSS_CLUSTALW in whatever dot shell control file you use for setting env.
for the bash shell, I edited .bashrc with:
export EMBOSS_CLUSTALW=/usr/local/bin/clustalw

How would one go about requesting that this sort of info be added as a comment to the application tfm page? So instead of reading 
COMMENT
none

it read: Set env variable EMBOSS_CLUSTALW=<path to local clustalw executalble>

thanks,
Tom

On Dec 8, 2009, at 12:13 PM, Tom Keller wrote:

> This is an ongoing frustration. I use EMBOSS only occasionally, and I can never find a good guide for setting environmental variables. For example, I wanted to use emma with a new install of clustalw2. I made a link to it in /usr/local/bin, but emma can't find it. How do I fix this in a easy to maintain manner? 
> 
> thanks,
> Tom
> 
> 
> Thomas (Tom) Keller
> kellert at ohsu.edu
> 503.494.2442
> 6339b R Jones Hall (BSc/CROET)
> www.ohsu.edu/xd/research/research-cores/dna-analysis/
> 
> 
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss

Thomas (Tom) Keller
kellert at ohsu.edu
503.494.2442
6339b R Jones Hall (BSc/CROET)
www.ohsu.edu/xd/research/research-cores/dna-analysis/



From pmr at ebi.ac.uk  Wed Dec  9 04:21:43 2009
From: pmr at ebi.ac.uk (Peter Rice)
Date: Wed, 09 Dec 2009 09:21:43 +0000
Subject: [EMBOSS] newbie emma (clustalw) question
In-Reply-To: <3A1B51FF-D28D-43DE-A555-E6B6D3163352@ohsu.edu>
References: <A678B499-9B4F-42CA-8EB4-935C29F9ECA0@ohsu.edu>
	<3A1B51FF-D28D-43DE-A555-E6B6D3163352@ohsu.edu>
Message-ID: <4B1F6C27.6050502@ebi.ac.uk>

On 08/12/09 21:08, Tom Keller wrote:
> On Dec 8, 2009, at 12:13 PM, Tom Keller wrote:
>> This is an ongoing frustration. I use EMBOSS only occasionally, and
>> I can never find a good guide for setting environmental variables.
>> For example, I wanted to use emma with a new install of clustalw2.
>> I made a link to it in /usr/local/bin, but emma can't find it. How
>> do I fix this in a easy to maintain manner?

You got there first.

The simple answer is that emma will look for clustalw (not clustalw2) in
your path. This should include a link. If you can run clustalw from the
command line then it should also run from within emma.

> I finally found the answer. It's simple, but if you don't know it,
> your only guessing, and that is really not a good approach.
>
> The environmental variable to set is EMBOSS_CLUSTALW in whatever dot
> shell control file you use for setting env.
> for the bash shell, I edited .bashrc with:
> export EMBOSS_CLUSTALW=/usr/local/bin/clustalw

This was a feature we added so that clustalw could be launched from a
local installation, or to run an executable called clustalw2 (or
clustalw183)

> How would one go about requesting that this sort of info be added as
> a comment to the application tfm page? So instead of reading
> COMMENT
> none
>
> it read: Set env variable EMBOSS_CLUSTALW=<path to local clustalw executalble>

You just did :-)

We will go through the external programs and add more information.

There is a paragraph in the emma documentation (diagnostic error
messages) but it is not easy to find (and probably has not been read by
many users - I just found a typo in it).

We plan for a future release to call all external applications in a
common way, and to issue a standard error message describing the path
and environment variable options.

We will also add a reference to external programs in the ACD files for
interface developers to identify dependencies on other packages.

We will also look into adding messages to the EMBOSS configure script to
warn about required third party packages.

Thanks for the suggestions

regards,

Peter Rice

From pmr at ebi.ac.uk  Thu Dec 10 08:36:14 2009
From: pmr at ebi.ac.uk (Peter Rice)
Date: Thu, 10 Dec 2009 13:36:14 +0000
Subject: [EMBOSS] EMBOSS 6.1.0 patch 1.3
Message-ID: <4B20F94E.4000506@ebi.ac.uk>

A patch for EMBOSS 6.1.0 is on the FTP server. This fixes problems with
extractfeat, using format names with dashes (fastq-sanger) in USAs,
scaling issues in plot outputs, and some minor bugs.

The files are on our FTP server ftp://emboss.open-bio.org/pub/EMBOSS/fixes
with a patch file and instructions in the patches subdirectory.

Fix 3. EMBOSS-6.1.0/ajax/ajfeat.c
        EMBOSS-6.1.0/ajax/ajfeat.h
        EMBOSS-6.1.0/ajax/ajgraph.c
        EMBOSS-6.1.0/ajax/ajmath.c
        EMBOSS-6.1.0/ajax/ajseq.c
        EMBOSS-6.1.0/ajax/ajseqread.c
        EMBOSS-6.1.0/ajax/ajseqwrite.c
        EMBOSS-6.1.0/nucleus/embmisc.c
        EMBOSS-6.1.0/nucleus/embmisc.h
        EMBOSS-6.1.0/nucleus/embpat.c
        EMBOSS-6.1.0/emboss/coderet.c
        EMBOSS-6.1.0/emboss/extractfeat.c
        EMBOSS-6.1.0/emboss/notseq.c
        EMBOSS-6.1.0/emboss/prettyplot.c
        EMBOSS-6.1.0/emboss/seqmatchall.c
        EMBOSS-6.1.0/emboss/showfeat.c
        EMBOSS-6.1.0/emboss/showpep.c
        EMBOSS-6.1.0/emboss/showseq.c
        EMBOSS-6.1.0/emboss/twofeat.c
        EMBOSS-6.1.0/jemboss/utils/install-jemboss-server.sh
 
EMBOSS-6.1.0/jemboss/org/emboss/jemboss/server/AppendToLogFileThread.java
 
EMBOSS-6.1.0/jemboss/org/emboss/jemboss/server/JembossAuthServer.java

02-Dec-2009: Fixes problems with extractfeat. The fix includes cleaner
              definitions of functions used to match feature tags and
              feature types which result in minor updates to 6 other
              applications.

              Extractfeat in previous versions used its own text parser
              to extract feature data from only a limited set of
              formats. In release 6.1.0 it was replaced by the standard
              EMBOSS feature table. With no options set, extractfeat
              rejected all features (type '*' was needed to extract
              features). Extractfeat default settings now extract all
              features from an entry.

              Features on the reverse strand were incorrectly processed
              (an effect caused by some of the old extractfeat code
              remaining). Reverse strand features are now correctly
              parsed, including both "join(complement())" and
              "complement(join())" syntax in EMBL/GenBank/DDBJ feature
              tables.

              Fixes an issue in GenBank parsing where the ORIGIN line is 
absent.

              Fixes scaling errors in prettyplot, especially in mEMBOSS
              when plotting to a window on screen (the default
              output). The plplot library does not report the true
              width and height for several devices. The assumptions in
              prettyplot depend on reasonable size estimates. Release
              6.2.0 will have further corrections to plplot device
              scaling.

	     Fixes the counting of non-coding features in coderet.

	     Fixes a seqmatchall error for short sequences with perfect matches

	     When reverse-complementing sequences, also reverses
	     the quality scores.

	     Allows '-' in format names in the USA syntax, to allow
	     fastq-sanger fastq-illumina and fastq-solexa format names
	     to be used.

	     When reading protein sequences, a sequence with only a
	     stop is now recognized as empty (zero length) after
	     processing ambiguity codes and stops.

	     Fixes a problem writing features in PIR format when the
	     feature table is empty, for example a report file with no hits.

	     Fixes a dependency on 'ant' to install a Jemboss server.

	     Fixes a problem in logging Jemboss info/error messages.



regards,

Peter Rice

From charles-listes-emboss at plessy.org  Mon Dec 14 06:59:18 2009
From: charles-listes-emboss at plessy.org (Charles Plessy)
Date: Mon, 14 Dec 2009 20:59:18 +0900
Subject: [EMBOSS] EMBOSS 6.1.0 patch 1.3
In-Reply-To: <4B20F94E.4000506@ebi.ac.uk>
References: <4B20F94E.4000506@ebi.ac.uk>
Message-ID: <20091214115918.GB22410@kunpuu.plessy.org>

Le Thu, Dec 10, 2009 at 01:36:14PM +0000, Peter Rice a ?crit :
> A patch for EMBOSS 6.1.0 is on the FTP server. This fixes problems with
> extractfeat, using format names with dashes (fastq-sanger) in USAs,
> scaling issues in plot outputs, and some minor bugs.
>
> The files are on our FTP server ftp://emboss.open-bio.org/pub/EMBOSS/fixes
> with a patch file and instructions in the patches subdirectory.
>
> Fix 3. EMBOSS-6.1.0/ajax/ajfeat.c
>        EMBOSS-6.1.0/ajax/ajfeat.h
>        EMBOSS-6.1.0/ajax/ajgraph.c
>        EMBOSS-6.1.0/ajax/ajmath.c
>        EMBOSS-6.1.0/ajax/ajseq.c
>        EMBOSS-6.1.0/ajax/ajseqread.c
>        EMBOSS-6.1.0/ajax/ajseqwrite.c
>        EMBOSS-6.1.0/nucleus/embmisc.c
>        EMBOSS-6.1.0/nucleus/embmisc.h
>        EMBOSS-6.1.0/nucleus/embpat.c
>        EMBOSS-6.1.0/emboss/coderet.c
>        EMBOSS-6.1.0/emboss/extractfeat.c
>        EMBOSS-6.1.0/emboss/notseq.c
>        EMBOSS-6.1.0/emboss/prettyplot.c
>        EMBOSS-6.1.0/emboss/seqmatchall.c
>        EMBOSS-6.1.0/emboss/showfeat.c
>        EMBOSS-6.1.0/emboss/showpep.c
>        EMBOSS-6.1.0/emboss/showseq.c
>        EMBOSS-6.1.0/emboss/twofeat.c
>        EMBOSS-6.1.0/jemboss/utils/install-jemboss-server.sh

Dear Peter and all EMBOSS developers,

There were two issues that were discussed previously on the EMBOSS user list or
on the sourceforge tracker, that I do not see fixed in this patch. The EMBOSS
package distributed by Debian contains a patch for each of them.

1) To prevent vectorstrip to discard FASTQ qualities.
http://git.debian.org/?p=debian-med/emboss.git;a=blob;f=debian/patches/transient-vectorstrip.patch;h=c4d8fd1e6c6d223ec8664b1aa08171407f9ace55;hb=HEAD
https://sourceforge.net/tracker/index.php?func=detail&aid=2886368&group_id=93650&atid=605034

2) To help tfm to find the HTML documentation.
http://git.debian.org/?p=debian-med/emboss.git;a=blob;f=debian/patches/tfm-html.patch;h=c0595eb5008f53fec27e0ba4ff144c6385c6acdd;hb=HEAD
https://sourceforge.net/tracker/?func=detail&aid=2877960&group_id=93650&atid=605031

I would welcome in particular comments on the second patch. If it is not
suitable, then I will remove it from the Debian package.

Best regards,

-- 
Charles Plessy
Debian Med packaging team,
http://www.debian.org/devel/debian-med
Tsurumi, Kanagawa, Japan

From pmr at ebi.ac.uk  Mon Dec 14 08:44:10 2009
From: pmr at ebi.ac.uk (Peter Rice)
Date: Mon, 14 Dec 2009 13:44:10 +0000
Subject: [EMBOSS] EMBOSS 6.1.0 patch 1.3
In-Reply-To: <20091214115918.GB22410@kunpuu.plessy.org>
References: <4B20F94E.4000506@ebi.ac.uk>
	<20091214115918.GB22410@kunpuu.plessy.org>
Message-ID: <4B26412A.5020906@ebi.ac.uk>

On 12/14/2009 11:59 AM, Charles Plessy wrote:

> There were two issues that were discussed previously on the EMBOSS user list or
> on the sourceforge tracker, that I do not see fixed in this patch. The EMBOSS
> package distributed by Debian contains a patch for each of them.
>
> 1) To prevent vectorstrip to discard FASTQ qualities.
> http://git.debian.org/?p=debian-med/emboss.git;a=blob;f=debian/patches/transient-vectorstrip.patch;h=c4d8fd1e6c6d223ec8664b1aa08171407f9ace55;hb=HEAD
> https://sourceforge.net/tracker/index.php?func=detail&aid=2886368&group_id=93650&atid=605034

Sorry, we missed that update in goiing through the changes in the 
ajseq.c file.

We will add it to the next patch.

> 2) To help tfm to find the HTML documentation.
> http://git.debian.org/?p=debian-med/emboss.git;a=blob;f=debian/patches/tfm-html.patch;h=c0595eb5008f53fec27e0ba4ff144c6385c6acdd;hb=HEAD
> https://sourceforge.net/tracker/?func=detail&aid=2877960&group_id=93650&atid=605031

This one is wrong. If the documentation is not found in the install 
directory (which it should be with a standard 'make install') tfm looks 
in ajNamValueBaseDir which is the top level directory.

The Debian patch uses ajNamValueRootDir which is the emboss/ 
subdirectory used when finding uninstalled ACD files.

embossversion -full shows both these paths.

Hope this helps,

Peter Rice

From stephen.taylor at imm.ox.ac.uk  Tue Dec 15 07:14:07 2009
From: stephen.taylor at imm.ox.ac.uk (Steve Taylor)
Date: Tue, 15 Dec 2009 12:14:07 +0000
Subject: [EMBOSS] Genpept entry in MSE
Message-ID: <4B277D8F.8010205@imm.ox.ac.uk>

Hi,

I am trying to load a Genpept entry into MSE, EMBOSS Version 6.0.1 on Fedora. Unfortunately it doesn't like the LOCUS line.

It loads, but warns:

Warning: bad Genbank LOCUS line 'LOCUS       ACN78416                 225 aa          linear   BCT 21-MAR-2009'

Changing the aa to bp fixes it.

Thanks,

Steve


LOCUS       ACN78416                 225 aa            linear   BCT 21-MAR-2009
DEFINITION  galactosyltransferase A [Pasteurella multocida].
ACCESSION   ACN78416
VERSION     ACN78416.1  GI:224999306
DBSOURCE    accession FJ755839.1
KEYWORDS    .
SOURCE      Pasteurella multocida
  ORGANISM  Pasteurella multocida
            Bacteria; Proteobacteria; Gammaproteobacteria; Pasteurellales;
            Pasteurellaceae; Pasteurella.
REFERENCE   1  (residues 1 to 225)
  AUTHORS   Boyce,J.D., Harper,M., St Michael,F., John,M., Aubry,A., Parnas,H.,
            Logan,S.M., Wilkie,I.W., Ford,M., Cox,A.D. and Adler,B.
  TITLE     Identification of novel glycosyltransferases required for assembly
            of the Pasteurella multocida A:1 lipopolysaccharide and their
            involvement in virulence
  JOURNAL   Infect. Immun. 77 (4), 1532-1542 (2009)
   PUBMED   19168738
REFERENCE   2  (residues 1 to 225)
  AUTHORS   Harper,M., John,M., Adler,B. and Boyce,J.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-FEB-2009) Microbiology, Monash University, Wellington
            road, Clayton, Melbourne, Victoria 3800, Australia
COMMENT     Method: conceptual translation supplied by author.
FEATURES             Location/Qualifiers
     source          1..225
                     /organism="Pasteurella multocida"
                     /strain="VP161"
                     /serotype="1"
                     /db_xref="taxon:747"
                     /note="serogroup: A"
     Protein         1..225
                     /product="galactosyltransferase A"
                     /function="adds beta-D-galactose to both the 4 and 6
                     position of alpha-L,D-heptose IV"
                     /name="putative bi-functional galactosyltransferase; GatA"
     Region          5..188
                     /region_name="Glyco_transf_25"
                     /note="Glycosyltransferase family 25 [lipooligosaccharide
                     (LOS) biosynthesis protein] is a family of
                     glycosyltransferases involved in LOS biosynthesis. The
                     members include the beta(1,4) galactosyltransferases: Lgt2
                     of Moraxella catarrhalis, LgtB and LgtE of...; cd06532"
                     /db_xref="CDD:133474"
     CDS             1..225
                     /gene="gatA"
                     /coded_by="FJ755839.1:1..678"
                     /transl_table=11
ORIGIN      
        1 mklpkiivis lknsprrqii shrlsglgld feffdavygk dltkeeleki dyeffpkycg
       61 skgaltlgei gcamshikiy ehivannleq viileddaiv slyfeeivla alqklpnrre
      121 ilfldhgkak vypfmrnlpe ryrlaryrkp skhskrfivr ttaylitleg akkllkhayp
      181 irmpsdfltg llqlthinay giepscvfgg veseinemer raglk
//

From biopython at maubp.freeserve.co.uk  Tue Dec 15 08:13:54 2009
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Tue, 15 Dec 2009 13:13:54 +0000
Subject: [EMBOSS] Genpept entry in MSE
In-Reply-To: <4B277D8F.8010205@imm.ox.ac.uk>
References: <4B277D8F.8010205@imm.ox.ac.uk>
Message-ID: <320fb6e00912150513g6ca79e70lf86bca737fef5f5f@mail.gmail.com>

On Tue, Dec 15, 2009 at 12:14 PM, Steve Taylor
<stephen.taylor at imm.ox.ac.uk> wrote:
>
> Hi,
>
> I am trying to load a Genpept entry into MSE, EMBOSS Version 6.0.1 on
> Fedora. Unfortunately it doesn't like the LOCUS line.
>
> It loads, but warns:
>
> Warning: bad Genbank LOCUS line 'LOCUS ? ? ? ACN78416 ? ? ? ? ? ? ? ? 225 aa
> ? ? ? ? ?linear ? BCT 21-MAR-2009'
>
> Changing the aa to bp fixes it.

What command line did you use? If you specified format "genbank",
I think you should use format name "genpept" or "refseqp" instead:
http://emboss.sourceforge.net/docs/themes/SequenceFormats.html

Peter


From stephen.taylor at imm.ox.ac.uk  Tue Dec 15 10:26:59 2009
From: stephen.taylor at imm.ox.ac.uk (Steve Taylor)
Date: Tue, 15 Dec 2009 15:26:59 +0000
Subject: [EMBOSS] Genpept entry in MSE
In-Reply-To: <320fb6e00912150513g6ca79e70lf86bca737fef5f5f@mail.gmail.com>
References: <4B277D8F.8010205@imm.ox.ac.uk>
	<320fb6e00912150513g6ca79e70lf86bca737fef5f5f@mail.gmail.com>
Message-ID: <4B27AAC3.9070209@imm.ox.ac.uk>

Peter wrote:
> On Tue, Dec 15, 2009 at 12:14 PM, Steve Taylor
> <stephen.taylor at imm.ox.ac.uk> wrote:
>> Hi,
>>
>> I am trying to load a Genpept entry into MSE, EMBOSS Version 6.0.1 on
>> Fedora. Unfortunately it doesn't like the LOCUS line.
>>
>> It loads, but warns:
>>
>> Warning: bad Genbank LOCUS line 'LOCUS       ACN78416                 225 aa
>>          linear   BCT 21-MAR-2009'
>>
>> Changing the aa to bp fixes it.
> 
> What command line did you use? If you specified format "genbank",
> I think you should use format name "genpept" or "refseqp" instead:
> http://emboss.sourceforge.net/docs/themes/SequenceFormats.html

I didn't specify any format. I assumed it would pick it up...

However, I still get the error if I use

mse -sformat1 genpept -sequence ACN78417.pep

Is this what you mean?

Steve

From biopython at maubp.freeserve.co.uk  Tue Dec 15 10:56:34 2009
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Tue, 15 Dec 2009 15:56:34 +0000
Subject: [EMBOSS] Genpept entry in MSE
In-Reply-To: <4B27AAC3.9070209@imm.ox.ac.uk>
References: <4B277D8F.8010205@imm.ox.ac.uk>
	<320fb6e00912150513g6ca79e70lf86bca737fef5f5f@mail.gmail.com>
	<4B27AAC3.9070209@imm.ox.ac.uk>
Message-ID: <320fb6e00912150756y2a213b21v1917be1b3133d3b4@mail.gmail.com>

On Tue, Dec 15, 2009 at 3:26 PM, Steve Taylor
<stephen.taylor at imm.ox.ac.uk> wrote:
>
> I didn't specify any format. I assumed it would pick it up...

Emboss is normally pretty good at deducing file formats, so I
would have expected it to cope too.

> However, I still get the error if I use
>
> mse -sformat1 genpept -sequence ACN78417.pep
>
> Is this what you mean?

Probably - although I don't think I have ever used mse myself.

Hopefully an EMBOSS developer can enlighten us.

Peter C.

From pmr at ebi.ac.uk  Tue Dec 15 11:41:34 2009
From: pmr at ebi.ac.uk (Peter Rice)
Date: Tue, 15 Dec 2009 16:41:34 +0000
Subject: [EMBOSS] Genpept entry in MSE
In-Reply-To: <320fb6e00912150756y2a213b21v1917be1b3133d3b4@mail.gmail.com>
References: <4B277D8F.8010205@imm.ox.ac.uk>	<320fb6e00912150513g6ca79e70lf86bca737fef5f5f@mail.gmail.com>	<4B27AAC3.9070209@imm.ox.ac.uk>
	<320fb6e00912150756y2a213b21v1917be1b3133d3b4@mail.gmail.com>
Message-ID: <4B27BC3E.3090601@ebi.ac.uk>

On 15/12/09 15:56, Peter wrote:
> On Tue, Dec 15, 2009 at 3:26 PM, Steve Taylor
> <stephen.taylor at imm.ox.ac.uk>  wrote:
>>
>> I didn't specify any format. I assumed it would pick it up...
>
> Emboss is normally pretty good at deducing file formats, so I
> would have expected it to cope too.
>
>> However, I still get the error if I use
>>
>> mse -sformat1 genpept -sequence ACN78417.pep
>>
>> Is this what you mean?
>
> Probably - although I don't think I have ever used mse myself.
>
> Hopefully an EMBOSS developer can enlighten us.

Which version of EMBOSS are you running?

We are looking into improving support for genpept and the refseq 
variants in a future release.

Genpept was cleaned up in one of the patches for 6.1.0 so this should 
address your problem.

regards,

Peter Rice


From kellert at ohsu.edu  Tue Dec 15 15:16:07 2009
From: kellert at ohsu.edu (Tom Keller)
Date: Tue, 15 Dec 2009 12:16:07 -0800
Subject: [EMBOSS] Macports/EMBOSS dyld issue
Message-ID: <B89312B6-C6E8-479A-96CA-651FDC4CC65B@ohsu.edu>

Hi,
I'm running Mac OS X 10.6, and have EMBOSS 6.0.1 installed via MacPorts. And I have macport installed jpeg.7.dylib at /opt/local/lib/

But I get the following error:
$ wossname wossname
dyld: Library not loaded: /opt/local/lib/libjpeg.62.dylib
  Referenced from: /opt/local/bin/wossname
  Reason: image not found
Trace/BPT trap

I tried making a link from jpeg.7.dylib to /opt/local/lib/libjpeg.62.dylib but then I get the error:

dyld: Library not loaded: /opt/local/lib/libjpeg.62.dylib
  Referenced from: /opt/local/bin/wossname
  Reason: Incompatible library version: wossname requires version 63.0.0 or later, but libjpeg.62.dylib provides version 8.0.0
Trace/BPT trap



Can someone suggest a solution?

Thomas (Tom) Keller
kellert at ohsu.edu
503.494.2442
6339b R Jones Hall (BSc/CROET)
www.ohsu.edu/xd/research/research-cores/dna-analysis/



From biopython at maubp.freeserve.co.uk  Tue Dec 15 16:21:22 2009
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Tue, 15 Dec 2009 21:21:22 +0000
Subject: [EMBOSS] Macports/EMBOSS dyld issue
In-Reply-To: <B89312B6-C6E8-479A-96CA-651FDC4CC65B@ohsu.edu>
References: <B89312B6-C6E8-479A-96CA-651FDC4CC65B@ohsu.edu>
Message-ID: <320fb6e00912151321r3453c849t32beb55888988021@mail.gmail.com>

On Tue, Dec 15, 2009 at 8:16 PM, Tom Keller <kellert at ohsu.edu> wrote:
>
> Hi,
> I'm running Mac OS X 10.6, and have EMBOSS 6.0.1 installed via MacPorts. And I have macport installed jpeg.7.dylib at /opt/local/lib/
>
> But I get the following error:
> $ wossname wossname
> dyld: Library not loaded: /opt/local/lib/libjpeg.62.dylib
> ?Referenced from: /opt/local/bin/wossname
> ?Reason: image not found
> Trace/BPT trap
>
> I tried making a link from jpeg.7.dylib to /opt/local/lib/libjpeg.62.dylib but then I get the error:
>
> dyld: Library not loaded: /opt/local/lib/libjpeg.62.dylib
> ?Referenced from: /opt/local/bin/wossname
> ?Reason: Incompatible library version: wossname requires version 63.0.0 or later, but libjpeg.62.dylib provides version 8.0.0
> Trace/BPT trap
>
> Can someone suggest a solution?
>
> Thomas (Tom) Keller
> kellert at ohsu.edu
> 503.494.2442
> 6339b R Jones Hall (BSc/CROET)
> www.ohsu.edu/xd/research/research-cores/dna-analysis/

That looks like two problems, you seem to have libjpeg 62.x.x
which is too old, but also EMBOSS (or dyld) isn't reporting the
same kind of version number. Do you (or MacPorts) have a
libjpeg.63.dylib file you could try?

[I've never tried this - this is an informed guess at best]

Peter


From d.leader at bio.gla.ac.uk  Wed Dec 16 07:29:56 2009
From: d.leader at bio.gla.ac.uk (David Leader)
Date: Wed, 16 Dec 2009 12:29:56 +0000
Subject: [EMBOSS] Rebase installation nightmare
Message-ID: <52CBBC8D-4374-4E88-AFE4-1A09F10E68CC@bio.gla.ac.uk>

I discovered that the programs using restriction enzymes do not work  
on my installations of EMBOSS:

ERROR   application terminated
    EMBOSS An error in remap.c at line 236:
Cannot locate enzyme file. Run REBASEEXTRACT

So I tried to follow the instructions on the EMBOSS site at sourceforge:
------------------------------------------------------------------------ 
--------

Rebase is the restriction enzyme database maintained by New England  
Biolabs. It is needed for programs such as remap and restrict.

The latest version of Rebase can be obtained by anonymous FTP.3.10  
EMBOSS needs the

withrefm
file. The data is extracted for EMBOSS with the program rebaseextract.

% mkdir /site/prog/emboss/data/REBASE
% rebaseextract
Extract data from REBASE
Full pathname of WITHREFM: /data/rebase/withrefm.208
Rebase is now installed and ready to use.

------------------------------------------------------

... FTP.3.10
ftp://ftp.ebi.ac.uk/pub/databases/rebase

------------------------------------------------------

1. I downloaded the file withrefm.912.Z and extracted the file  
withrefm.912
2. I attempted to make a directory called REBASE but it already  
existed at /usr/local/EMBOSS-3.0.0/emboss/data/REBASE on my OS X  
installation. The contents were;

Makefile.am     Makefile.in     dummyfile

3. OK, so I tried to run rebaseextract:

david: rebaseextract
Extract data from REBASE
Full pathname of WITHREFM file: /Users/david/withrefm.912
Full pathname of PROTO file:

Nothing in the instructions about a PROTO file. Go back to the ftp  
site and download proto.912

Full pathname of PROTO file: /Users/david/proto.912

    EMBOSS An error in ajfile.c at line 2173:
Cannot write to file /usr/local/share/EMBOSS/data/REBASE/embossre.enz

4.   So I check whether there is a directory /usr/local/share/EMBOSS/ 
data/REBASE. There is, with a file entitled "dummyfile".

5. Give up. Life's too short to learn C.

David

___________________________________________________

Dr. David P. Leader, Faculty of Biomedical & Life Sciences,
University of Glasgow, Glasgow G12 8QQ, UK
Phone: +44 (0)141 330 5905
http://doolittle.ibls.gla.ac.uk/leader
http://motif.gla.ac.uk/

The University of Glasgow, charity number SC004401
___________________________________________________






From uludag at ebi.ac.uk  Wed Dec 16 09:12:45 2009
From: uludag at ebi.ac.uk (Mahmut Uludag)
Date: Wed, 16 Dec 2009 14:12:45 +0000
Subject: [EMBOSS] Rebase installation nightmare
In-Reply-To: <52CBBC8D-4374-4E88-AFE4-1A09F10E68CC@bio.gla.ac.uk>
References: <52CBBC8D-4374-4E88-AFE4-1A09F10E68CC@bio.gla.ac.uk>
Message-ID: <1260972765.1497.97.camel@emboss1.ebi.ac.uk>

Hi David,


>     EMBOSS An error in ajfile.c at line 2173:
> Cannot write to file /usr/local/share/EMBOSS/data/REBASE/embossre.enz

This could be a simple write permission error. Typically above location
(/usr/local/share/) should be updated using admin accounts.

I also noticed that your EMBOSS version is not one of the recent
releases. I don't know whether there has been any major changes in
rebase file syntax during last few years that would make EMBOSS-3 not
compatible with latest rebase files.

Regards,
Mahmut



From gbottu at vub.ac.be  Wed Dec 16 09:28:34 2009
From: gbottu at vub.ac.be (Guy Bottu)
Date: Wed, 16 Dec 2009 15:28:34 +0100
Subject: [EMBOSS] Rebase installation nightmare
In-Reply-To: <52CBBC8D-4374-4E88-AFE4-1A09F10E68CC@bio.gla.ac.uk>
References: <52CBBC8D-4374-4E88-AFE4-1A09F10E68CC@bio.gla.ac.uk>
Message-ID: <4B28EE92.8000903@vub.ac.be>

Yes, this is an old pain. It is difficult to find good EMBOSS 
documentation. Should improbe when John Ison puts the new manual on-line...

> 4.   So I check whether there is a directory 
> /usr/local/share/EMBOSS/data/REBASE. There is, with a file entitled 
> "dummyfile".

Is the directory REBASE writable for the UNIX user who runs the program 
rebaseextract ?

	Guy Bottu



From d.leader at bio.gla.ac.uk  Wed Dec 16 09:57:21 2009
From: d.leader at bio.gla.ac.uk (David Leader)
Date: Wed, 16 Dec 2009 14:57:21 +0000
Subject: [EMBOSS] Rebase installation nightmare
Message-ID: <0F56441F-517A-416D-B9B5-75C1B6AF68F9@bio.gla.ac.uk>


> I discovered that the programs using restriction enzymes do not  
> work on my installations of EMBOSS:
>
> ERROR   application terminated
>    EMBOSS An error in remap.c at line 236:
> Cannot locate enzyme file. Run REBASEEXTRACT
>
> So I tried to follow the instructions on the EMBOSS site at  
> sourceforge:


OK, woken from the nightmare, thanks to Guy and Mahmut. Always forget  
that even though I'm an admin user at the GUI level on my Mac I need  
to sudo to install things on the terminal.

(In my defence, if I hadn't been asked for files that weren't  
mentioned in the docs I might have considered that it was my fault  
rather than emboss's.)

David

___________________________________________________

Dr. David P. Leader, Faculty of Biomedical & Life Sciences,
University of Glasgow, Glasgow G12 8QQ, UK
Phone: +44 (0)141 330 5905
http://doolittle.ibls.gla.ac.uk/leader
http://motif.gla.ac.uk/

The University of Glasgow, charity number SC004401
___________________________________________________






From sean at seanmcollins.com  Tue Dec 22 09:24:29 2009
From: sean at seanmcollins.com (Sean Collins)
Date: Tue, 22 Dec 2009 09:24:29 -0500
Subject: [EMBOSS] EMBOSS amd64 packages
Message-ID: <96FA7C41-3AED-403B-A9A7-56EA8603C049@seanmcollins.com>

Hello,

I have built amd64 packages of the latest stable EMBOSS  
(emboss.sourceforge.net) release for CentOS 5.4 and would like to  
share them with the community. I have spec files, SRPMS and RPMs.

Thank You,
Sean Collins


From belegdol at gmail.com  Tue Dec 22 14:59:45 2009
From: belegdol at gmail.com (Julian Sikorski)
Date: Tue, 22 Dec 2009 20:59:45 +0100
Subject: [EMBOSS] EMBOSS amd64 packages
In-Reply-To: <96FA7C41-3AED-403B-A9A7-56EA8603C049@seanmcollins.com>
References: <96FA7C41-3AED-403B-A9A7-56EA8603C049@seanmcollins.com>
Message-ID: <hgr8fg$c3g$1@ger.gmane.org>

W dniu 22.12.2009 15:24, Sean Collins pisze:
> Hello,
> 
> I have built amd64 packages of the latest stable EMBOSS
> (emboss.sourceforge.net) release for CentOS 5.4 and would like to share
> them with the community. I have spec files, SRPMS and RPMs.
> 
> Thank You,
> Sean Collins
Hi,

I package EMBOSS for Fedora. Did you create your spec files from
scratch, or did you use mine as a basis? Maybe we could join forces and
you could co-maintain emboss in the EL branch? Are you a Fedora packager?

Julian


From sean at seanmcollins.com  Tue Dec 22 15:38:43 2009
From: sean at seanmcollins.com (Sean Collins)
Date: Tue, 22 Dec 2009 15:38:43 -0500
Subject: [EMBOSS] EMBOSS amd64 packages
In-Reply-To: <hgr8fg$c3g$1@ger.gmane.org>
References: <96FA7C41-3AED-403B-A9A7-56EA8603C049@seanmcollins.com>
	<hgr8fg$c3g$1@ger.gmane.org>
Message-ID: <8A6FFA1B-DE98-41C6-88AD-09AE1150F935@seanmcollins.com>

Hi Julian, pleasure to speak with you.

On Dec 22, 2009, at 2:59 PM, Julian Sikorski wrote:

> I package EMBOSS for Fedora. Did you create your spec files from
> scratch, or did you use mine as a basis?

I extracted spec files from the Emboss 5.0.0 RPM on the emboss site,  
which has Ryan Golhar <golharam at umdnj.edu> listed in the %changelog  
section.

> Maybe we could join forces and
> you could co-maintain emboss in the EL branch? Are you a Fedora  
> packager?

I am not a Fedora packager but would be happy to become one to  
maintain an EL/EPEL branch of EMBOSS.

Thank You,
Sean Collins


From michael.watson at bbsrc.ac.uk  Tue Dec  1 14:33:23 2009
From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C))
Date: Tue, 1 Dec 2009 14:33:23 +0000
Subject: [EMBOSS] Trimming illumina short reads based on quality
Message-ID: <8D08960C647E64438CE5740657CBBDC50148732064@iahcexch1.iah.bbsrc.ac.uk>

Hi

I'm sorry if I've not been keeping up to date on what is doubtless a hot topic.

Does EMBOSS allow one to trim short reads based on quality data (from a fastq file)?

If not, I have read that it is planned - any idea when it will be implemented?

Otherwise, alternative suggestions are welcome!

Thanks
Mick




From golharam at umdnj.edu  Tue Dec  1 15:46:20 2009
From: golharam at umdnj.edu (Ryan Golhar)
Date: Tue, 01 Dec 2009 10:46:20 -0500
Subject: [EMBOSS] Trimming illumina short reads based on quality
In-Reply-To: <8D08960C647E64438CE5740657CBBDC50148732064@iahcexch1.iah.bbsrc.ac.uk>
References: <8D08960C647E64438CE5740657CBBDC50148732064@iahcexch1.iah.bbsrc.ac.uk>
Message-ID: <4B153A4C.6000904@umdnj.edu>

Michael,

Doesn't Illumina provide tools to do this?  I know with ABI Solid data, 
they have a perl script capable of trimming data based on quality scores.

Ryan


michael watson (IAH-C) wrote:
> Hi
> 
> I'm sorry if I've not been keeping up to date on what is doubtless a hot topic.
> 
> Does EMBOSS allow one to trim short reads based on quality data (from a fastq file)?
> 
> If not, I have read that it is planned - any idea when it will be implemented?
> 
> Otherwise, alternative suggestions are welcome!
> 
> Thanks
> Mick
> 
> 
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss
> 


From d.m.a.martin at dundee.ac.uk  Tue Dec  1 16:16:21 2009
From: d.m.a.martin at dundee.ac.uk (David Martin)
Date: Tue, 01 Dec 2009 16:16:21 +0000
Subject: [EMBOSS] Trimming illumina short reads based on quality
In-Reply-To: <4B153A4C.6000904@umdnj.edu>
References: <8D08960C647E64438CE5740657CBBDC50148732064@iahcexch1.iah.bbsrc.ac.uk>
	<4B153A4C.6000904@umdnj.edu>
Message-ID: <4B154155.6F09.00E0.1@dundee.ac.uk>

>>> On 12/1/2009 at  3:46 PM, in message <4B153A4C.6000904 at umdnj.edu>, Ryan Golhar <golharam at umdnj.edu> wrote:
I think virtually every man and his dog who has done anything with Illumina reads has a variety of perl scripts that do this. It depends how you want to do the trimming. Do you want to clip to a specific length, clip on quality (absolute or average over a window) and do you have a minimum length requirement? 

Do you want to clip 3' and 5' ends or just one? 

..d 


Michael,

Doesn't Illumina provide tools to do this?  I know with ABI Solid data,
they have a perl script capable of trimming data based on quality scores.

Ryan


michael watson (IAH-C) wrote:
> Hi
>
> I'm sorry if I've not been keeping up to date on what is doubtless a hot topic.
>
> Does EMBOSS allow one to trim short reads based on quality data (from a fastq file)?
>
> If not, I have read that it is planned - any idea when it will be implemented?
>
> Otherwise, alternative suggestions are welcome!
> 



David Martin PhD
College of Life Sciences
University of Dundee 
The University of Dundee is a Scottish Registered Charity, No. SC015096.


The University of Dundee is a registered Scottish charity, No: SC015096



From matthias.dodt at mdc-berlin.de  Tue Dec  1 16:17:48 2009
From: matthias.dodt at mdc-berlin.de (Matthias Dodt)
Date: Tue, 01 Dec 2009 17:17:48 +0100
Subject: [EMBOSS] using sixpack
Message-ID: <4B1541AC.8000301@mdc-berlin.de>

Hi there!

I have some problems using sixpack for 6-frame translation. I want to 
convert a fasta file of contigs with sixpack. The command is:

sixpack contigs.fa -outseq protein_sequence

The problem is that sixpack only converts the first sequence in the 
fasta file. How can i force it to process the whole file??

thanks!

greetings

mat



From ztu at msi.umn.edu  Tue Dec  1 18:38:54 2009
From: ztu at msi.umn.edu (Zheng Jin Tu)
Date: Tue, 1 Dec 2009 12:38:54 -0600 (CST)
Subject: [EMBOSS] Trimming illumina short reads based on quality
In-Reply-To: <4B154155.6F09.00E0.1@dundee.ac.uk>
References: <8D08960C647E64438CE5740657CBBDC50148732064@iahcexch1.iah.bbsrc.ac.uk>
	<4B153A4C.6000904@umdnj.edu> <4B154155.6F09.00E0.1@dundee.ac.uk>
Message-ID: <Pine.LNX.4.63.0912011223350.16025@l11.msi.umn.edu>


Need to find bioinformatician to do the coding.

Not sure how to set correct filter parameters
but just sharing some experiences:

Basically person will check both sequence string and quality 
string from xxx_qseq.txt file.  Match each nucleotide and quality
in char level:

454, qual 20 is 95% and 40 99% confident if I am correct.

In GA, qual score is bit coded and can be 
read out by ord function in perl:
   
 qualcore = ord( quality_char ) - 64;

Not sure the cut off appropriate value. B is quality score 2.  
Thus at least we remove these BBBBB.  May set another min length filter 
to get rid of less than like 10 nucleotides read after 
trimming for low quality score.

Set another one max_score or avg_score filter, like 5, it can 
filter out the third and forth sequences in below lines.

R0174436        1       8       119     0       1418    0       1       
.GATCTTCTCCTTCACCTCCTCCAGGTCCTTGGTCAGCTCAGCACGCAGAG     
Bb^`bb____bbaaVI_Zbbaba`X_bb`aUbbb`W\\a^\bbT[_Xb]__     0
R0174436        1       8       119     0       991     0       1       
.GCCAATCTGTACTTGTCTTCTTCAGTTCCCACTTTGAATACCGCACAGTC     
BaGT]]bb[]`_]abaIaaaVbb^``abbaM`Ubbb`babaQT]XS_[a[B     0
R0174436        1       8       119     1791    1559    0       1       
A..................................................     
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB     0
R0174436        1       8       119     1791    1997    0       1       
A..................................................     
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB     0

Some people also look for trimming down poly T in RNA-seq
case. But not sure how many TTTT should be out. Or also
do AAAA case for reverse case?

Finally better output to fastq file format.

@R0174436:6:83:0:1815#0/1
.GTCAATGCGTTCCACCCCCTCTGGGTAGCCTCCAACATCATGTACGTCGA
+R0174436:6:83:0:1815#0/1
Ba`babbb]bb\Xb]b___V^^aaaa___Z_\_[aaa]babb`X`^b\bbb
@R0174436:6:83:0:506#0/1
.GCAGGAGAAGCATTTTATCTTTGTATTTTCTTCACTGGCAACAACAATGT
+R0174436:6:83:0:506#0/1
BaOW_\I]__a``a_\_J_HU_V_J\a`aa^bab^^]]]Y]^`[`[T]]\^

Good luck.

TU

===================================================

On Tue, 1 Dec 2009, David Martin wrote:

> >>> On 12/1/2009 at  3:46 PM, in message <4B153A4C.6000904 at umdnj.edu>, Ryan Golhar <golharam at umdnj.edu> wrote:
> I think virtually every man and his dog who has done anything with Illumina reads has a variety of perl scripts that do this. It depends how you want to do the trimming. Do you want to clip to a specific length, clip on quality (absolute or average over a window) and do you have a minimum length requirement? 
> 
> Do you want to clip 3' and 5' ends or just one? 
> 
> ..d 
> 
> 
> Michael,
> 
> Doesn't Illumina provide tools to do this?  I know with ABI Solid data,
> they have a perl script capable of trimming data based on quality scores.
> 
> Ryan
> 
> 
> michael watson (IAH-C) wrote:
> > Hi
> >
> > I'm sorry if I've not been keeping up to date on what is doubtless a hot topic.
> >
> > Does EMBOSS allow one to trim short reads based on quality data (from a fastq file)?
> >
> > If not, I have read that it is planned - any idea when it will be implemented?
> >
> > Otherwise, alternative suggestions are welcome!
> > 
> 
> 
> 
> David Martin PhD
> College of Life Sciences
> University of Dundee 
> The University of Dundee is a Scottish Registered Charity, No. SC015096.
> 
> 
> The University of Dundee is a registered Scottish charity, No: SC015096
> 
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss
> 



From biopython at maubp.freeserve.co.uk  Tue Dec  1 19:45:58 2009
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Tue, 1 Dec 2009 19:45:58 +0000
Subject: [EMBOSS] Trimming illumina short reads based on quality
In-Reply-To: <8D08960C647E64438CE5740657CBBDC50148732064@iahcexch1.iah.bbsrc.ac.uk>
References: <8D08960C647E64438CE5740657CBBDC50148732064@iahcexch1.iah.bbsrc.ac.uk>
Message-ID: <320fb6e00912011145i2111042ap222cd8fdaef0364b@mail.gmail.com>

On Tue, Dec 1, 2009 at 2:33 PM, michael watson (IAH-C)
<michael.watson at bbsrc.ac.uk> wrote:
>
> Hi
>
> I'm sorry if I've not been keeping up to date on what is doubtless a hot topic.
>
> Does EMBOSS allow one to trim short reads based on quality data (from a fastq file)?
>
> If not, I have read that it is planned - any idea when it will be implemented?

Not yet, but it has been proposed and I understand it is on the
EMBOSS to do list along with quality filtering (Peter Rice has
suggested the name quaffle for this):
http://lists.open-bio.org/pipermail/bioperl-l/2009-July/030493.html

I dare say suggestions for precise trimming algorithms (e.g. median
over sliding window) might be welcome.

> Otherwise, alternative suggestions are welcome!

I'm sure there are plenty of scripts out these, in Perl, Python etc.
What is your language of choice?

Peter C.


From zen.lu at roslin.ed.ac.uk  Tue Dec  1 20:15:46 2009
From: zen.lu at roslin.ed.ac.uk (zen lu (RI))
Date: Tue, 1 Dec 2009 20:15:46 +0000
Subject: [EMBOSS] Trimming illumina short reads based on quality
In-Reply-To: <8D08960C647E64438CE5740657CBBDC50148732064@iahcexch1.iah.bbsrc.ac.uk>
References: <8D08960C647E64438CE5740657CBBDC50148732064@iahcexch1.iah.bbsrc.ac.uk>
Message-ID: <050C9A545DC1D84BAC7A678B76A56C3C251E351D24@ebrcexch1.ebrc.bbsrc.ac.uk>

The fastx-toolkit may be what you are looking for:
http://hannonlab.cshl.edu/fastx_toolkit/
________________________________________
From: emboss-bounces at lists.open-bio.org [emboss-bounces at lists.open-bio.org] On Behalf Of michael watson (IAH-C) [michael.watson at bbsrc.ac.uk]
Sent: 01 December 2009 14:33
To: emboss at lists.open-bio.org
Subject: [EMBOSS] Trimming illumina short reads based on quality

Hi

I'm sorry if I've not been keeping up to date on what is doubtless a hot topic.

Does EMBOSS allow one to trim short reads based on quality data (from a fastq file)?

If not, I have read that it is planned - any idea when it will be implemented?

Otherwise, alternative suggestions are welcome!

Thanks
Mick


_______________________________________________
EMBOSS mailing list
EMBOSS at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/emboss



From pmr at ebi.ac.uk  Wed Dec  2 09:43:42 2009
From: pmr at ebi.ac.uk (Peter Rice)
Date: Wed, 02 Dec 2009 09:43:42 +0000
Subject: [EMBOSS] using sixpack
In-Reply-To: <4B1541AC.8000301@mdc-berlin.de>
References: <4B1541AC.8000301@mdc-berlin.de>
Message-ID: <4B1636CE.6050403@ebi.ac.uk>

On 12/01/2009 04:17 PM, Matthias Dodt wrote:
> Hi there!
>
> I have some problems using sixpack for 6-frame translation. I want to
> convert a fasta file of contigs with sixpack. The command is:
>
> sixpack contigs.fa -outseq protein_sequence
>
> The problem is that sixpack only converts the first sequence in the
> fasta file. How can i force it to process the whole file??

Two options:

One is to change the EMBOSS code to loop over each sequence.

The other is to write a script that extracts each sequence in turn and
launches sixpack.

We can consider this for the next EMBOSS release. It applies to other
applications too. In general, would users (and developers of web and
other interfaces) be happy if more applications could read every
sequence in a fasta file?

This raises questions of how to mark up the output so that it is clear
where each results comes from. There will always be applications where
it is more sensible to proces sonly a single sequence.

A third option (there is so often another way):

getorf will find and report open reading frames in all input sequences

getorf contigs.fa -outseq protein_sequence

There will be differences in the output - getorf limits ORFs to 30
nucleotides. You get the same effect in sixpack with -orfmin 10 (oops,
sixpack counts amino acids - we will try to make them consistent in the
next release!)

You can also add -minsize 3 to the getorf command line to report all
ORFs like sixpack does.

Hope this helps,

Peter Rice


From matthias.dodt at mdc-berlin.de  Thu Dec  3 09:39:43 2009
From: matthias.dodt at mdc-berlin.de (Matthias Dodt)
Date: Thu, 03 Dec 2009 10:39:43 +0100
Subject: [EMBOSS] using sixpack
In-Reply-To: <4B1636CE.6050403@ebi.ac.uk>
References: <4B1541AC.8000301@mdc-berlin.de> <4B1636CE.6050403@ebi.ac.uk>
Message-ID: <4B17875F.80803@mdc-berlin.de>

Hello Peter!

Thank you very much, getorf is sufficient for me-

greetings

mat

Peter Rice schrieb:
> On 12/01/2009 04:17 PM, Matthias Dodt wrote:
>> Hi there!
>>
>> I have some problems using sixpack for 6-frame translation. I want to
>> convert a fasta file of contigs with sixpack. The command is:
>>
>> sixpack contigs.fa -outseq protein_sequence
>>
>> The problem is that sixpack only converts the first sequence in the
>> fasta file. How can i force it to process the whole file??
>
> Two options:
>
> One is to change the EMBOSS code to loop over each sequence.
>
> The other is to write a script that extracts each sequence in turn and
> launches sixpack.
>
> We can consider this for the next EMBOSS release. It applies to other
> applications too. In general, would users (and developers of web and
> other interfaces) be happy if more applications could read every
> sequence in a fasta file?
>
> This raises questions of how to mark up the output so that it is clear
> where each results comes from. There will always be applications where
> it is more sensible to proces sonly a single sequence.
>
> A third option (there is so often another way):
>
> getorf will find and report open reading frames in all input sequences
>
> getorf contigs.fa -outseq protein_sequence
>
> There will be differences in the output - getorf limits ORFs to 30
> nucleotides. You get the same effect in sixpack with -orfmin 10 (oops,
> sixpack counts amino acids - we will try to make them consistent in the
> next release!)
>
> You can also add -minsize 3 to the getorf command line to report all
> ORFs like sixpack does.
>
> Hope this helps,
>
> Peter Rice

-- 
------------------------------------------------
Matthias Dodt

Scientific Programmer at Bioinformatics platform AG Dieterich

Berlin Institute for Medical Systems Biology at the
Max-Delbrueck-Center for Molecular Medicine
Robert-Roessle-Strasse 10, 13125 Berlin, Germany

fon: +49 30 9406 4261
email: matthias.dodt at mdc-berlin.de



From biopython at maubp.freeserve.co.uk  Mon Dec  7 19:36:30 2009
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Mon, 7 Dec 2009 19:36:30 +0000
Subject: [EMBOSS] Unknown output format 'refseqp' and 'genpept'
In-Reply-To: <mailman.23123.1260214251.2696.emboss@lists.open-bio.org>
References: <mailman.23123.1260214251.2696.emboss@lists.open-bio.org>
Message-ID: <320fb6e00912071136i26de9cadx9da04e1527999345@mail.gmail.com>

Hi,

I have a protein IntelliGenetics file used in the Biopython test suite:
http://biopython.org/SRC/biopython/Tests/IntelliGenetics/VIF_mase-pro.txt

I am using EMBOSS 6.1.0 (patch level 2 I think), and I am trying
to turn this into a "GenBank Protein File", or GenPept file, using
EMBOSS seqret.

EMBOSS can read the file fine, this works:
$ seqret -auto -sformat=ig -osformat=fasta VIF_mase-pro.txt temp.txt

Giving FASTA output with 16 gapped protein sequences, which is
good - although the ID of the first record is a bit odd.

Using "genbank" as the output format in EMBOSS seems to
mean nucleotide and not protein:

$ seqret -auto -sformat=ig -osformat=genbank VIF_mase-pro.txt temp.txt
Error: Sequence format 'genbank' not supported for protein sequences
Error: Sequence format 'genbank' not supported for protein sequences
...
Error: Sequence format 'genbank' not supported for protein sequences

Referring to the documentation,
http://emboss.sourceforge.net/docs/themes/SequenceFormats.html
I then tried "genpept" and "refseqp":

$ seqret -auto -sformat=ig -osformat=genpept VIF_mase-pro.txt temp.txt
Error: Unknown output format 'genpept'
Error: Unknown output format 'genpept'
...
Error: unknown output format 'genpept'

$ seqret -auto -sformat=ig -osformat=refseqp VIF_mase-pro.txt temp.txt
Error: Unknown output format 'refseqp'
Error: Unknown output format 'refseqp'
...
Error: unknown output format 'refseqp'

Doesn't EMBOSS seqret support genpept/refseqp as an output format?

Thanks,

Peter C.


From pmr at ebi.ac.uk  Tue Dec  8 13:32:41 2009
From: pmr at ebi.ac.uk (Peter Rice)
Date: Tue, 08 Dec 2009 13:32:41 +0000
Subject: [EMBOSS] Unknown output format 'refseqp' and 'genpept'
In-Reply-To: <320fb6e00912071136i26de9cadx9da04e1527999345@mail.gmail.com>
References: <mailman.23123.1260214251.2696.emboss@lists.open-bio.org>
	<320fb6e00912071136i26de9cadx9da04e1527999345@mail.gmail.com>
Message-ID: <4B1E5579.2070407@ebi.ac.uk>

Peter wrote:
> Hi,
> 
> I have a protein IntelliGenetics file used in the Biopython test suite:
> http://biopython.org/SRC/biopython/Tests/IntelliGenetics/VIF_mase-pro.txt
> 
> I am using EMBOSS 6.1.0 (patch level 2 I think), and I am trying
> to turn this into a "GenBank Protein File", or GenPept file, using
> EMBOSS seqret.
>
> Doesn't EMBOSS seqret support genpept/refseqp as an output format?

Oddly enough you are the first to ask for it.

Does biopython have a definition of the fields it expects to write out 
in a GenPept or RefseqP format file? We would be able to allow GenBank 
as an alias for, presumably, genpept.

Might be a good time to merge the format names and details from 
biopython and emboss. Where can Ifine the biopython ones?

regards,

Peter


From biopython at maubp.freeserve.co.uk  Tue Dec  8 13:53:13 2009
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Tue, 8 Dec 2009 13:53:13 +0000
Subject: [EMBOSS] Unknown output format 'refseqp' and 'genpept'
In-Reply-To: <4B1E5579.2070407@ebi.ac.uk>
References: <mailman.23123.1260214251.2696.emboss@lists.open-bio.org>
	<320fb6e00912071136i26de9cadx9da04e1527999345@mail.gmail.com>
	<4B1E5579.2070407@ebi.ac.uk>
Message-ID: <320fb6e00912080553w490f66vffab00edbe192069@mail.gmail.com>

On Tue, Dec 8, 2009 at 1:32 PM, Peter Rice <pmr at ebi.ac.uk> wrote:
>
> Peter wrote:
>>
>> Hi,
>>
>> I have a protein IntelliGenetics file used in the Biopython test suite:
>> http://biopython.org/SRC/biopython/Tests/IntelliGenetics/VIF_mase-pro.txt

It probably doesn't matter what the input file is here, the fact that
it was an (obsolete) format like IntelliGenetics was just chance as
I was working on a Biopython unit test.

>> I am using EMBOSS 6.1.0 (patch level 2 I think), and I am trying
>> to turn this into a "GenBank Protein File", or GenPept file, using
>> EMBOSS seqret.
>>
>> Doesn't EMBOSS seqret support genpept/refseqp as an output format?
>
> Oddly enough you are the first to ask for it.

That surprises me a little bit.

Could I suggest you treat known input formats which are not supported
as output formats a little differently and instead of this:

unknown output format 'genpept'

Perhaps give,

format 'genpept' is not supported for output (only input)

This would help the user rule out having a typo etc.

> Does biopython have a definition of the fields it expects to write out in a
> GenPept or RefseqP format file? We would be able to allow GenBank as an
> alias for, presumably, genpept.

Not explicitly, no. I was hoping to use EMBOSS for cross validation ;)

With hindsight this may have been a mistake, but we use "genbank"
format to mean either nucleotides of proteins. On parsing we just
look at the units of length in the LOCUS line (bp or aa). We also
try to cope with both the current NCBI files and some older variants
we have in our unit tests (different offsets in the LOCUS line).

> Might be a good time to merge the format names and details from biopython
> and emboss. Where can Ifine the biopython ones?

There are two tables on the wiki which include version information:
http://biopython.org/wiki/SeqIO
http://biopython.org/wiki/AlignIO

You can also consult the built in documentation, also available online:
http://biopython.org/DIST/docs/api/Bio.SeqIO-module.html
http://biopython.org/DIST/docs/api/Bio.AlignIO-module.html

For a long time I avoided having aliases (multiple names for the same
thing). However, we now treat "gb" as an alias for "genbank" (since
this is what the NCBI use in Entrez). We also treat "fastq-sanger" and
"fastq" the same.

Peter C (the one at Biopython)


From pmr at ebi.ac.uk  Tue Dec  8 14:11:59 2009
From: pmr at ebi.ac.uk (Peter Rice)
Date: Tue, 08 Dec 2009 14:11:59 +0000
Subject: [EMBOSS] Unknown output format 'refseqp' and 'genpept'
In-Reply-To: <320fb6e00912080553w490f66vffab00edbe192069@mail.gmail.com>
References: <mailman.23123.1260214251.2696.emboss@lists.open-bio.org>	
	<320fb6e00912071136i26de9cadx9da04e1527999345@mail.gmail.com>	
	<4B1E5579.2070407@ebi.ac.uk>
	<320fb6e00912080553w490f66vffab00edbe192069@mail.gmail.com>
Message-ID: <4B1E5EAF.80301@ebi.ac.uk>

Peter C. wrote:
> Could I suggest you treat known input formats which are not supported
> as output formats a little differently and instead of this:
> 
> unknown output format 'genpept'
> 
> Perhaps give,
> 
> format 'genpept' is not supported for output (only input)
> 
> This would help the user rule out having a typo etc.

A useful suggestion. We can apply that to feature formats too. I'll see 
what I can do.

may be worth a tidy up on what we do with formats that are only valid 
for nucleotide or protein (though that is a little tricky as we 
currently try to let some fail over to an equivalent format.

>> Does biopython have a definition of the fields it expects to write out in a
>> GenPept or RefseqP format file? We would be able to allow GenBank as an
>> alias for, presumably, genpept.
> 
> Not explicitly, no. I was hoping to use EMBOSS for cross validation ;)

No problem. We'll go first then and try to define standard formats.

> With hindsight this may have been a mistake, but we use "genbank"
> format to mean either nucleotides of proteins. On parsing we just
> look at the units of length in the LOCUS line (bp or aa). We also
> try to cope with both the current NCBI files and some older variants
> we have in our unit tests (different offsets in the LOCUS line).

We try that too on input, but for output we have to be explicit so the 
user can pick just one of the choices.

regards,

Peter R.


From biopython at maubp.freeserve.co.uk  Tue Dec  8 14:29:25 2009
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Tue, 8 Dec 2009 14:29:25 +0000
Subject: [EMBOSS] Unknown output format 'refseqp' and 'genpept'
In-Reply-To: <4B1E5EAF.80301@ebi.ac.uk>
References: <mailman.23123.1260214251.2696.emboss@lists.open-bio.org>
	<320fb6e00912071136i26de9cadx9da04e1527999345@mail.gmail.com>
	<4B1E5579.2070407@ebi.ac.uk>
	<320fb6e00912080553w490f66vffab00edbe192069@mail.gmail.com>
	<4B1E5EAF.80301@ebi.ac.uk>
Message-ID: <320fb6e00912080629h969fc27m46dc0165ff1832d0@mail.gmail.com>

On Tue, Dec 8, 2009 at 2:11 PM, Peter Rice <pmr at ebi.ac.uk> wrote:
>
>> With hindsight this may have been a mistake, but we use "genbank"
>> format to mean either nucleotides of proteins. On parsing we just
>> look at the units of length in the LOCUS line (bp or aa). We also
>> try to cope with both the current NCBI files and some older variants
>> we have in our unit tests (different offsets in the LOCUS line).
>
> We try that too on input, but for output we have to be explicit so the user
> can pick just one of the choices.

I imagine that as with Biopython, sometimes the user has made it
explicit that they are dealing with nucleotides or proteins (lots of
the EMBOSS tools have switches for this), so you know if you
should be using "aa" or "bp" in the LOCUS line.

Peter


From kellert at ohsu.edu  Tue Dec  8 20:13:36 2009
From: kellert at ohsu.edu (Tom Keller)
Date: Tue, 8 Dec 2009 12:13:36 -0800
Subject: [EMBOSS] newbie emma (clustalw) question
Message-ID: <A678B499-9B4F-42CA-8EB4-935C29F9ECA0@ohsu.edu>

This is an ongoing frustration. I use EMBOSS only occasionally, and I can never find a good guide for setting environmental variables. For example, I wanted to use emma with a new install of clustalw2. I made a link to it in /usr/local/bin, but emma can't find it. How do I fix this in a easy to maintain manner? 

thanks,
Tom


Thomas (Tom) Keller
kellert at ohsu.edu
503.494.2442
6339b R Jones Hall (BSc/CROET)
www.ohsu.edu/xd/research/research-cores/dna-analysis/




From kellert at ohsu.edu  Tue Dec  8 21:08:54 2009
From: kellert at ohsu.edu (Tom Keller)
Date: Tue, 8 Dec 2009 13:08:54 -0800
Subject: [EMBOSS] newbie emma (clustalw) question
In-Reply-To: <A678B499-9B4F-42CA-8EB4-935C29F9ECA0@ohsu.edu>
References: <A678B499-9B4F-42CA-8EB4-935C29F9ECA0@ohsu.edu>
Message-ID: <3A1B51FF-D28D-43DE-A555-E6B6D3163352@ohsu.edu>

I finally found the answer. It's simple, but if you don't know it, your only guessing, and that is really not a good approach. 
The environmental variable to set is EMBOSS_CLUSTALW in whatever dot shell control file you use for setting env.
for the bash shell, I edited .bashrc with:
export EMBOSS_CLUSTALW=/usr/local/bin/clustalw

How would one go about requesting that this sort of info be added as a comment to the application tfm page? So instead of reading 
COMMENT
none

it read: Set env variable EMBOSS_CLUSTALW=<path to local clustalw executalble>

thanks,
Tom

On Dec 8, 2009, at 12:13 PM, Tom Keller wrote:

> This is an ongoing frustration. I use EMBOSS only occasionally, and I can never find a good guide for setting environmental variables. For example, I wanted to use emma with a new install of clustalw2. I made a link to it in /usr/local/bin, but emma can't find it. How do I fix this in a easy to maintain manner? 
> 
> thanks,
> Tom
> 
> 
> Thomas (Tom) Keller
> kellert at ohsu.edu
> 503.494.2442
> 6339b R Jones Hall (BSc/CROET)
> www.ohsu.edu/xd/research/research-cores/dna-analysis/
> 
> 
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss

Thomas (Tom) Keller
kellert at ohsu.edu
503.494.2442
6339b R Jones Hall (BSc/CROET)
www.ohsu.edu/xd/research/research-cores/dna-analysis/




From pmr at ebi.ac.uk  Wed Dec  9 09:21:43 2009
From: pmr at ebi.ac.uk (Peter Rice)
Date: Wed, 09 Dec 2009 09:21:43 +0000
Subject: [EMBOSS] newbie emma (clustalw) question
In-Reply-To: <3A1B51FF-D28D-43DE-A555-E6B6D3163352@ohsu.edu>
References: <A678B499-9B4F-42CA-8EB4-935C29F9ECA0@ohsu.edu>
	<3A1B51FF-D28D-43DE-A555-E6B6D3163352@ohsu.edu>
Message-ID: <4B1F6C27.6050502@ebi.ac.uk>

On 08/12/09 21:08, Tom Keller wrote:
> On Dec 8, 2009, at 12:13 PM, Tom Keller wrote:
>> This is an ongoing frustration. I use EMBOSS only occasionally, and
>> I can never find a good guide for setting environmental variables.
>> For example, I wanted to use emma with a new install of clustalw2.
>> I made a link to it in /usr/local/bin, but emma can't find it. How
>> do I fix this in a easy to maintain manner?

You got there first.

The simple answer is that emma will look for clustalw (not clustalw2) in
your path. This should include a link. If you can run clustalw from the
command line then it should also run from within emma.

> I finally found the answer. It's simple, but if you don't know it,
> your only guessing, and that is really not a good approach.
>
> The environmental variable to set is EMBOSS_CLUSTALW in whatever dot
> shell control file you use for setting env.
> for the bash shell, I edited .bashrc with:
> export EMBOSS_CLUSTALW=/usr/local/bin/clustalw

This was a feature we added so that clustalw could be launched from a
local installation, or to run an executable called clustalw2 (or
clustalw183)

> How would one go about requesting that this sort of info be added as
> a comment to the application tfm page? So instead of reading
> COMMENT
> none
>
> it read: Set env variable EMBOSS_CLUSTALW=<path to local clustalw executalble>

You just did :-)

We will go through the external programs and add more information.

There is a paragraph in the emma documentation (diagnostic error
messages) but it is not easy to find (and probably has not been read by
many users - I just found a typo in it).

We plan for a future release to call all external applications in a
common way, and to issue a standard error message describing the path
and environment variable options.

We will also add a reference to external programs in the ACD files for
interface developers to identify dependencies on other packages.

We will also look into adding messages to the EMBOSS configure script to
warn about required third party packages.

Thanks for the suggestions

regards,

Peter Rice


From pmr at ebi.ac.uk  Thu Dec 10 13:36:14 2009
From: pmr at ebi.ac.uk (Peter Rice)
Date: Thu, 10 Dec 2009 13:36:14 +0000
Subject: [EMBOSS] EMBOSS 6.1.0 patch 1.3
Message-ID: <4B20F94E.4000506@ebi.ac.uk>

A patch for EMBOSS 6.1.0 is on the FTP server. This fixes problems with
extractfeat, using format names with dashes (fastq-sanger) in USAs,
scaling issues in plot outputs, and some minor bugs.

The files are on our FTP server ftp://emboss.open-bio.org/pub/EMBOSS/fixes
with a patch file and instructions in the patches subdirectory.

Fix 3. EMBOSS-6.1.0/ajax/ajfeat.c
        EMBOSS-6.1.0/ajax/ajfeat.h
        EMBOSS-6.1.0/ajax/ajgraph.c
        EMBOSS-6.1.0/ajax/ajmath.c
        EMBOSS-6.1.0/ajax/ajseq.c
        EMBOSS-6.1.0/ajax/ajseqread.c
        EMBOSS-6.1.0/ajax/ajseqwrite.c
        EMBOSS-6.1.0/nucleus/embmisc.c
        EMBOSS-6.1.0/nucleus/embmisc.h
        EMBOSS-6.1.0/nucleus/embpat.c
        EMBOSS-6.1.0/emboss/coderet.c
        EMBOSS-6.1.0/emboss/extractfeat.c
        EMBOSS-6.1.0/emboss/notseq.c
        EMBOSS-6.1.0/emboss/prettyplot.c
        EMBOSS-6.1.0/emboss/seqmatchall.c
        EMBOSS-6.1.0/emboss/showfeat.c
        EMBOSS-6.1.0/emboss/showpep.c
        EMBOSS-6.1.0/emboss/showseq.c
        EMBOSS-6.1.0/emboss/twofeat.c
        EMBOSS-6.1.0/jemboss/utils/install-jemboss-server.sh
 
EMBOSS-6.1.0/jemboss/org/emboss/jemboss/server/AppendToLogFileThread.java
 
EMBOSS-6.1.0/jemboss/org/emboss/jemboss/server/JembossAuthServer.java

02-Dec-2009: Fixes problems with extractfeat. The fix includes cleaner
              definitions of functions used to match feature tags and
              feature types which result in minor updates to 6 other
              applications.

              Extractfeat in previous versions used its own text parser
              to extract feature data from only a limited set of
              formats. In release 6.1.0 it was replaced by the standard
              EMBOSS feature table. With no options set, extractfeat
              rejected all features (type '*' was needed to extract
              features). Extractfeat default settings now extract all
              features from an entry.

              Features on the reverse strand were incorrectly processed
              (an effect caused by some of the old extractfeat code
              remaining). Reverse strand features are now correctly
              parsed, including both "join(complement())" and
              "complement(join())" syntax in EMBL/GenBank/DDBJ feature
              tables.

              Fixes an issue in GenBank parsing where the ORIGIN line is 
absent.

              Fixes scaling errors in prettyplot, especially in mEMBOSS
              when plotting to a window on screen (the default
              output). The plplot library does not report the true
              width and height for several devices. The assumptions in
              prettyplot depend on reasonable size estimates. Release
              6.2.0 will have further corrections to plplot device
              scaling.

	     Fixes the counting of non-coding features in coderet.

	     Fixes a seqmatchall error for short sequences with perfect matches

	     When reverse-complementing sequences, also reverses
	     the quality scores.

	     Allows '-' in format names in the USA syntax, to allow
	     fastq-sanger fastq-illumina and fastq-solexa format names
	     to be used.

	     When reading protein sequences, a sequence with only a
	     stop is now recognized as empty (zero length) after
	     processing ambiguity codes and stops.

	     Fixes a problem writing features in PIR format when the
	     feature table is empty, for example a report file with no hits.

	     Fixes a dependency on 'ant' to install a Jemboss server.

	     Fixes a problem in logging Jemboss info/error messages.



regards,

Peter Rice


From charles-listes-emboss at plessy.org  Mon Dec 14 11:59:18 2009
From: charles-listes-emboss at plessy.org (Charles Plessy)
Date: Mon, 14 Dec 2009 20:59:18 +0900
Subject: [EMBOSS] EMBOSS 6.1.0 patch 1.3
In-Reply-To: <4B20F94E.4000506@ebi.ac.uk>
References: <4B20F94E.4000506@ebi.ac.uk>
Message-ID: <20091214115918.GB22410@kunpuu.plessy.org>

Le Thu, Dec 10, 2009 at 01:36:14PM +0000, Peter Rice a ?crit :
> A patch for EMBOSS 6.1.0 is on the FTP server. This fixes problems with
> extractfeat, using format names with dashes (fastq-sanger) in USAs,
> scaling issues in plot outputs, and some minor bugs.
>
> The files are on our FTP server ftp://emboss.open-bio.org/pub/EMBOSS/fixes
> with a patch file and instructions in the patches subdirectory.
>
> Fix 3. EMBOSS-6.1.0/ajax/ajfeat.c
>        EMBOSS-6.1.0/ajax/ajfeat.h
>        EMBOSS-6.1.0/ajax/ajgraph.c
>        EMBOSS-6.1.0/ajax/ajmath.c
>        EMBOSS-6.1.0/ajax/ajseq.c
>        EMBOSS-6.1.0/ajax/ajseqread.c
>        EMBOSS-6.1.0/ajax/ajseqwrite.c
>        EMBOSS-6.1.0/nucleus/embmisc.c
>        EMBOSS-6.1.0/nucleus/embmisc.h
>        EMBOSS-6.1.0/nucleus/embpat.c
>        EMBOSS-6.1.0/emboss/coderet.c
>        EMBOSS-6.1.0/emboss/extractfeat.c
>        EMBOSS-6.1.0/emboss/notseq.c
>        EMBOSS-6.1.0/emboss/prettyplot.c
>        EMBOSS-6.1.0/emboss/seqmatchall.c
>        EMBOSS-6.1.0/emboss/showfeat.c
>        EMBOSS-6.1.0/emboss/showpep.c
>        EMBOSS-6.1.0/emboss/showseq.c
>        EMBOSS-6.1.0/emboss/twofeat.c
>        EMBOSS-6.1.0/jemboss/utils/install-jemboss-server.sh

Dear Peter and all EMBOSS developers,

There were two issues that were discussed previously on the EMBOSS user list or
on the sourceforge tracker, that I do not see fixed in this patch. The EMBOSS
package distributed by Debian contains a patch for each of them.

1) To prevent vectorstrip to discard FASTQ qualities.
http://git.debian.org/?p=debian-med/emboss.git;a=blob;f=debian/patches/transient-vectorstrip.patch;h=c4d8fd1e6c6d223ec8664b1aa08171407f9ace55;hb=HEAD
https://sourceforge.net/tracker/index.php?func=detail&aid=2886368&group_id=93650&atid=605034

2) To help tfm to find the HTML documentation.
http://git.debian.org/?p=debian-med/emboss.git;a=blob;f=debian/patches/tfm-html.patch;h=c0595eb5008f53fec27e0ba4ff144c6385c6acdd;hb=HEAD
https://sourceforge.net/tracker/?func=detail&aid=2877960&group_id=93650&atid=605031

I would welcome in particular comments on the second patch. If it is not
suitable, then I will remove it from the Debian package.

Best regards,

-- 
Charles Plessy
Debian Med packaging team,
http://www.debian.org/devel/debian-med
Tsurumi, Kanagawa, Japan


From pmr at ebi.ac.uk  Mon Dec 14 13:44:10 2009
From: pmr at ebi.ac.uk (Peter Rice)
Date: Mon, 14 Dec 2009 13:44:10 +0000
Subject: [EMBOSS] EMBOSS 6.1.0 patch 1.3
In-Reply-To: <20091214115918.GB22410@kunpuu.plessy.org>
References: <4B20F94E.4000506@ebi.ac.uk>
	<20091214115918.GB22410@kunpuu.plessy.org>
Message-ID: <4B26412A.5020906@ebi.ac.uk>

On 12/14/2009 11:59 AM, Charles Plessy wrote:

> There were two issues that were discussed previously on the EMBOSS user list or
> on the sourceforge tracker, that I do not see fixed in this patch. The EMBOSS
> package distributed by Debian contains a patch for each of them.
>
> 1) To prevent vectorstrip to discard FASTQ qualities.
> http://git.debian.org/?p=debian-med/emboss.git;a=blob;f=debian/patches/transient-vectorstrip.patch;h=c4d8fd1e6c6d223ec8664b1aa08171407f9ace55;hb=HEAD
> https://sourceforge.net/tracker/index.php?func=detail&aid=2886368&group_id=93650&atid=605034

Sorry, we missed that update in goiing through the changes in the 
ajseq.c file.

We will add it to the next patch.

> 2) To help tfm to find the HTML documentation.
> http://git.debian.org/?p=debian-med/emboss.git;a=blob;f=debian/patches/tfm-html.patch;h=c0595eb5008f53fec27e0ba4ff144c6385c6acdd;hb=HEAD
> https://sourceforge.net/tracker/?func=detail&aid=2877960&group_id=93650&atid=605031

This one is wrong. If the documentation is not found in the install 
directory (which it should be with a standard 'make install') tfm looks 
in ajNamValueBaseDir which is the top level directory.

The Debian patch uses ajNamValueRootDir which is the emboss/ 
subdirectory used when finding uninstalled ACD files.

embossversion -full shows both these paths.

Hope this helps,

Peter Rice


From stephen.taylor at imm.ox.ac.uk  Tue Dec 15 12:14:07 2009
From: stephen.taylor at imm.ox.ac.uk (Steve Taylor)
Date: Tue, 15 Dec 2009 12:14:07 +0000
Subject: [EMBOSS] Genpept entry in MSE
Message-ID: <4B277D8F.8010205@imm.ox.ac.uk>

Hi,

I am trying to load a Genpept entry into MSE, EMBOSS Version 6.0.1 on Fedora. Unfortunately it doesn't like the LOCUS line.

It loads, but warns:

Warning: bad Genbank LOCUS line 'LOCUS       ACN78416                 225 aa          linear   BCT 21-MAR-2009'

Changing the aa to bp fixes it.

Thanks,

Steve


LOCUS       ACN78416                 225 aa            linear   BCT 21-MAR-2009
DEFINITION  galactosyltransferase A [Pasteurella multocida].
ACCESSION   ACN78416
VERSION     ACN78416.1  GI:224999306
DBSOURCE    accession FJ755839.1
KEYWORDS    .
SOURCE      Pasteurella multocida
  ORGANISM  Pasteurella multocida
            Bacteria; Proteobacteria; Gammaproteobacteria; Pasteurellales;
            Pasteurellaceae; Pasteurella.
REFERENCE   1  (residues 1 to 225)
  AUTHORS   Boyce,J.D., Harper,M., St Michael,F., John,M., Aubry,A., Parnas,H.,
            Logan,S.M., Wilkie,I.W., Ford,M., Cox,A.D. and Adler,B.
  TITLE     Identification of novel glycosyltransferases required for assembly
            of the Pasteurella multocida A:1 lipopolysaccharide and their
            involvement in virulence
  JOURNAL   Infect. Immun. 77 (4), 1532-1542 (2009)
   PUBMED   19168738
REFERENCE   2  (residues 1 to 225)
  AUTHORS   Harper,M., John,M., Adler,B. and Boyce,J.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-FEB-2009) Microbiology, Monash University, Wellington
            road, Clayton, Melbourne, Victoria 3800, Australia
COMMENT     Method: conceptual translation supplied by author.
FEATURES             Location/Qualifiers
     source          1..225
                     /organism="Pasteurella multocida"
                     /strain="VP161"
                     /serotype="1"
                     /db_xref="taxon:747"
                     /note="serogroup: A"
     Protein         1..225
                     /product="galactosyltransferase A"
                     /function="adds beta-D-galactose to both the 4 and 6
                     position of alpha-L,D-heptose IV"
                     /name="putative bi-functional galactosyltransferase; GatA"
     Region          5..188
                     /region_name="Glyco_transf_25"
                     /note="Glycosyltransferase family 25 [lipooligosaccharide
                     (LOS) biosynthesis protein] is a family of
                     glycosyltransferases involved in LOS biosynthesis. The
                     members include the beta(1,4) galactosyltransferases: Lgt2
                     of Moraxella catarrhalis, LgtB and LgtE of...; cd06532"
                     /db_xref="CDD:133474"
     CDS             1..225
                     /gene="gatA"
                     /coded_by="FJ755839.1:1..678"
                     /transl_table=11
ORIGIN      
        1 mklpkiivis lknsprrqii shrlsglgld feffdavygk dltkeeleki dyeffpkycg
       61 skgaltlgei gcamshikiy ehivannleq viileddaiv slyfeeivla alqklpnrre
      121 ilfldhgkak vypfmrnlpe ryrlaryrkp skhskrfivr ttaylitleg akkllkhayp
      181 irmpsdfltg llqlthinay giepscvfgg veseinemer raglk
//


From biopython at maubp.freeserve.co.uk  Tue Dec 15 13:13:54 2009
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Tue, 15 Dec 2009 13:13:54 +0000
Subject: [EMBOSS] Genpept entry in MSE
In-Reply-To: <4B277D8F.8010205@imm.ox.ac.uk>
References: <4B277D8F.8010205@imm.ox.ac.uk>
Message-ID: <320fb6e00912150513g6ca79e70lf86bca737fef5f5f@mail.gmail.com>

On Tue, Dec 15, 2009 at 12:14 PM, Steve Taylor
<stephen.taylor at imm.ox.ac.uk> wrote:
>
> Hi,
>
> I am trying to load a Genpept entry into MSE, EMBOSS Version 6.0.1 on
> Fedora. Unfortunately it doesn't like the LOCUS line.
>
> It loads, but warns:
>
> Warning: bad Genbank LOCUS line 'LOCUS ? ? ? ACN78416 ? ? ? ? ? ? ? ? 225 aa
> ? ? ? ? ?linear ? BCT 21-MAR-2009'
>
> Changing the aa to bp fixes it.

What command line did you use? If you specified format "genbank",
I think you should use format name "genpept" or "refseqp" instead:
http://emboss.sourceforge.net/docs/themes/SequenceFormats.html

Peter



From stephen.taylor at imm.ox.ac.uk  Tue Dec 15 15:26:59 2009
From: stephen.taylor at imm.ox.ac.uk (Steve Taylor)
Date: Tue, 15 Dec 2009 15:26:59 +0000
Subject: [EMBOSS] Genpept entry in MSE
In-Reply-To: <320fb6e00912150513g6ca79e70lf86bca737fef5f5f@mail.gmail.com>
References: <4B277D8F.8010205@imm.ox.ac.uk>
	<320fb6e00912150513g6ca79e70lf86bca737fef5f5f@mail.gmail.com>
Message-ID: <4B27AAC3.9070209@imm.ox.ac.uk>

Peter wrote:
> On Tue, Dec 15, 2009 at 12:14 PM, Steve Taylor
> <stephen.taylor at imm.ox.ac.uk> wrote:
>> Hi,
>>
>> I am trying to load a Genpept entry into MSE, EMBOSS Version 6.0.1 on
>> Fedora. Unfortunately it doesn't like the LOCUS line.
>>
>> It loads, but warns:
>>
>> Warning: bad Genbank LOCUS line 'LOCUS       ACN78416                 225 aa
>>          linear   BCT 21-MAR-2009'
>>
>> Changing the aa to bp fixes it.
> 
> What command line did you use? If you specified format "genbank",
> I think you should use format name "genpept" or "refseqp" instead:
> http://emboss.sourceforge.net/docs/themes/SequenceFormats.html

I didn't specify any format. I assumed it would pick it up...

However, I still get the error if I use

mse -sformat1 genpept -sequence ACN78417.pep

Is this what you mean?

Steve


From biopython at maubp.freeserve.co.uk  Tue Dec 15 15:56:34 2009
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Tue, 15 Dec 2009 15:56:34 +0000
Subject: [EMBOSS] Genpept entry in MSE
In-Reply-To: <4B27AAC3.9070209@imm.ox.ac.uk>
References: <4B277D8F.8010205@imm.ox.ac.uk>
	<320fb6e00912150513g6ca79e70lf86bca737fef5f5f@mail.gmail.com>
	<4B27AAC3.9070209@imm.ox.ac.uk>
Message-ID: <320fb6e00912150756y2a213b21v1917be1b3133d3b4@mail.gmail.com>

On Tue, Dec 15, 2009 at 3:26 PM, Steve Taylor
<stephen.taylor at imm.ox.ac.uk> wrote:
>
> I didn't specify any format. I assumed it would pick it up...

Emboss is normally pretty good at deducing file formats, so I
would have expected it to cope too.

> However, I still get the error if I use
>
> mse -sformat1 genpept -sequence ACN78417.pep
>
> Is this what you mean?

Probably - although I don't think I have ever used mse myself.

Hopefully an EMBOSS developer can enlighten us.

Peter C.


From pmr at ebi.ac.uk  Tue Dec 15 16:41:34 2009
From: pmr at ebi.ac.uk (Peter Rice)
Date: Tue, 15 Dec 2009 16:41:34 +0000
Subject: [EMBOSS] Genpept entry in MSE
In-Reply-To: <320fb6e00912150756y2a213b21v1917be1b3133d3b4@mail.gmail.com>
References: <4B277D8F.8010205@imm.ox.ac.uk>	<320fb6e00912150513g6ca79e70lf86bca737fef5f5f@mail.gmail.com>	<4B27AAC3.9070209@imm.ox.ac.uk>
	<320fb6e00912150756y2a213b21v1917be1b3133d3b4@mail.gmail.com>
Message-ID: <4B27BC3E.3090601@ebi.ac.uk>

On 15/12/09 15:56, Peter wrote:
> On Tue, Dec 15, 2009 at 3:26 PM, Steve Taylor
> <stephen.taylor at imm.ox.ac.uk>  wrote:
>>
>> I didn't specify any format. I assumed it would pick it up...
>
> Emboss is normally pretty good at deducing file formats, so I
> would have expected it to cope too.
>
>> However, I still get the error if I use
>>
>> mse -sformat1 genpept -sequence ACN78417.pep
>>
>> Is this what you mean?
>
> Probably - although I don't think I have ever used mse myself.
>
> Hopefully an EMBOSS developer can enlighten us.

Which version of EMBOSS are you running?

We are looking into improving support for genpept and the refseq 
variants in a future release.

Genpept was cleaned up in one of the patches for 6.1.0 so this should 
address your problem.

regards,

Peter Rice



From kellert at ohsu.edu  Tue Dec 15 20:16:07 2009
From: kellert at ohsu.edu (Tom Keller)
Date: Tue, 15 Dec 2009 12:16:07 -0800
Subject: [EMBOSS] Macports/EMBOSS dyld issue
Message-ID: <B89312B6-C6E8-479A-96CA-651FDC4CC65B@ohsu.edu>

Hi,
I'm running Mac OS X 10.6, and have EMBOSS 6.0.1 installed via MacPorts. And I have macport installed jpeg.7.dylib at /opt/local/lib/

But I get the following error:
$ wossname wossname
dyld: Library not loaded: /opt/local/lib/libjpeg.62.dylib
  Referenced from: /opt/local/bin/wossname
  Reason: image not found
Trace/BPT trap

I tried making a link from jpeg.7.dylib to /opt/local/lib/libjpeg.62.dylib but then I get the error:

dyld: Library not loaded: /opt/local/lib/libjpeg.62.dylib
  Referenced from: /opt/local/bin/wossname
  Reason: Incompatible library version: wossname requires version 63.0.0 or later, but libjpeg.62.dylib provides version 8.0.0
Trace/BPT trap



Can someone suggest a solution?

Thomas (Tom) Keller
kellert at ohsu.edu
503.494.2442
6339b R Jones Hall (BSc/CROET)
www.ohsu.edu/xd/research/research-cores/dna-analysis/




From biopython at maubp.freeserve.co.uk  Tue Dec 15 21:21:22 2009
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Tue, 15 Dec 2009 21:21:22 +0000
Subject: [EMBOSS] Macports/EMBOSS dyld issue
In-Reply-To: <B89312B6-C6E8-479A-96CA-651FDC4CC65B@ohsu.edu>
References: <B89312B6-C6E8-479A-96CA-651FDC4CC65B@ohsu.edu>
Message-ID: <320fb6e00912151321r3453c849t32beb55888988021@mail.gmail.com>

On Tue, Dec 15, 2009 at 8:16 PM, Tom Keller <kellert at ohsu.edu> wrote:
>
> Hi,
> I'm running Mac OS X 10.6, and have EMBOSS 6.0.1 installed via MacPorts. And I have macport installed jpeg.7.dylib at /opt/local/lib/
>
> But I get the following error:
> $ wossname wossname
> dyld: Library not loaded: /opt/local/lib/libjpeg.62.dylib
> ?Referenced from: /opt/local/bin/wossname
> ?Reason: image not found
> Trace/BPT trap
>
> I tried making a link from jpeg.7.dylib to /opt/local/lib/libjpeg.62.dylib but then I get the error:
>
> dyld: Library not loaded: /opt/local/lib/libjpeg.62.dylib
> ?Referenced from: /opt/local/bin/wossname
> ?Reason: Incompatible library version: wossname requires version 63.0.0 or later, but libjpeg.62.dylib provides version 8.0.0
> Trace/BPT trap
>
> Can someone suggest a solution?
>
> Thomas (Tom) Keller
> kellert at ohsu.edu
> 503.494.2442
> 6339b R Jones Hall (BSc/CROET)
> www.ohsu.edu/xd/research/research-cores/dna-analysis/

That looks like two problems, you seem to have libjpeg 62.x.x
which is too old, but also EMBOSS (or dyld) isn't reporting the
same kind of version number. Do you (or MacPorts) have a
libjpeg.63.dylib file you could try?

[I've never tried this - this is an informed guess at best]

Peter



From d.leader at bio.gla.ac.uk  Wed Dec 16 12:29:56 2009
From: d.leader at bio.gla.ac.uk (David Leader)
Date: Wed, 16 Dec 2009 12:29:56 +0000
Subject: [EMBOSS] Rebase installation nightmare
Message-ID: <52CBBC8D-4374-4E88-AFE4-1A09F10E68CC@bio.gla.ac.uk>

I discovered that the programs using restriction enzymes do not work  
on my installations of EMBOSS:

ERROR   application terminated
    EMBOSS An error in remap.c at line 236:
Cannot locate enzyme file. Run REBASEEXTRACT

So I tried to follow the instructions on the EMBOSS site at sourceforge:
------------------------------------------------------------------------ 
--------

Rebase is the restriction enzyme database maintained by New England  
Biolabs. It is needed for programs such as remap and restrict.

The latest version of Rebase can be obtained by anonymous FTP.3.10  
EMBOSS needs the

withrefm
file. The data is extracted for EMBOSS with the program rebaseextract.

% mkdir /site/prog/emboss/data/REBASE
% rebaseextract
Extract data from REBASE
Full pathname of WITHREFM: /data/rebase/withrefm.208
Rebase is now installed and ready to use.

------------------------------------------------------

... FTP.3.10
ftp://ftp.ebi.ac.uk/pub/databases/rebase

------------------------------------------------------

1. I downloaded the file withrefm.912.Z and extracted the file  
withrefm.912
2. I attempted to make a directory called REBASE but it already  
existed at /usr/local/EMBOSS-3.0.0/emboss/data/REBASE on my OS X  
installation. The contents were;

Makefile.am     Makefile.in     dummyfile

3. OK, so I tried to run rebaseextract:

david: rebaseextract
Extract data from REBASE
Full pathname of WITHREFM file: /Users/david/withrefm.912
Full pathname of PROTO file:

Nothing in the instructions about a PROTO file. Go back to the ftp  
site and download proto.912

Full pathname of PROTO file: /Users/david/proto.912

    EMBOSS An error in ajfile.c at line 2173:
Cannot write to file /usr/local/share/EMBOSS/data/REBASE/embossre.enz

4.   So I check whether there is a directory /usr/local/share/EMBOSS/ 
data/REBASE. There is, with a file entitled "dummyfile".

5. Give up. Life's too short to learn C.

David

___________________________________________________

Dr. David P. Leader, Faculty of Biomedical & Life Sciences,
University of Glasgow, Glasgow G12 8QQ, UK
Phone: +44 (0)141 330 5905
http://doolittle.ibls.gla.ac.uk/leader
http://motif.gla.ac.uk/

The University of Glasgow, charity number SC004401
___________________________________________________







From uludag at ebi.ac.uk  Wed Dec 16 14:12:45 2009
From: uludag at ebi.ac.uk (Mahmut Uludag)
Date: Wed, 16 Dec 2009 14:12:45 +0000
Subject: [EMBOSS] Rebase installation nightmare
In-Reply-To: <52CBBC8D-4374-4E88-AFE4-1A09F10E68CC@bio.gla.ac.uk>
References: <52CBBC8D-4374-4E88-AFE4-1A09F10E68CC@bio.gla.ac.uk>
Message-ID: <1260972765.1497.97.camel@emboss1.ebi.ac.uk>

Hi David,


>     EMBOSS An error in ajfile.c at line 2173:
> Cannot write to file /usr/local/share/EMBOSS/data/REBASE/embossre.enz

This could be a simple write permission error. Typically above location
(/usr/local/share/) should be updated using admin accounts.

I also noticed that your EMBOSS version is not one of the recent
releases. I don't know whether there has been any major changes in
rebase file syntax during last few years that would make EMBOSS-3 not
compatible with latest rebase files.

Regards,
Mahmut




From gbottu at vub.ac.be  Wed Dec 16 14:28:34 2009
From: gbottu at vub.ac.be (Guy Bottu)
Date: Wed, 16 Dec 2009 15:28:34 +0100
Subject: [EMBOSS] Rebase installation nightmare
In-Reply-To: <52CBBC8D-4374-4E88-AFE4-1A09F10E68CC@bio.gla.ac.uk>
References: <52CBBC8D-4374-4E88-AFE4-1A09F10E68CC@bio.gla.ac.uk>
Message-ID: <4B28EE92.8000903@vub.ac.be>

Yes, this is an old pain. It is difficult to find good EMBOSS 
documentation. Should improbe when John Ison puts the new manual on-line...

> 4.   So I check whether there is a directory 
> /usr/local/share/EMBOSS/data/REBASE. There is, with a file entitled 
> "dummyfile".

Is the directory REBASE writable for the UNIX user who runs the program 
rebaseextract ?

	Guy Bottu




From d.leader at bio.gla.ac.uk  Wed Dec 16 14:57:21 2009
From: d.leader at bio.gla.ac.uk (David Leader)
Date: Wed, 16 Dec 2009 14:57:21 +0000
Subject: [EMBOSS] Rebase installation nightmare
Message-ID: <0F56441F-517A-416D-B9B5-75C1B6AF68F9@bio.gla.ac.uk>


> I discovered that the programs using restriction enzymes do not  
> work on my installations of EMBOSS:
>
> ERROR   application terminated
>    EMBOSS An error in remap.c at line 236:
> Cannot locate enzyme file. Run REBASEEXTRACT
>
> So I tried to follow the instructions on the EMBOSS site at  
> sourceforge:


OK, woken from the nightmare, thanks to Guy and Mahmut. Always forget  
that even though I'm an admin user at the GUI level on my Mac I need  
to sudo to install things on the terminal.

(In my defence, if I hadn't been asked for files that weren't  
mentioned in the docs I might have considered that it was my fault  
rather than emboss's.)

David

___________________________________________________

Dr. David P. Leader, Faculty of Biomedical & Life Sciences,
University of Glasgow, Glasgow G12 8QQ, UK
Phone: +44 (0)141 330 5905
http://doolittle.ibls.gla.ac.uk/leader
http://motif.gla.ac.uk/

The University of Glasgow, charity number SC004401
___________________________________________________







From sean at seanmcollins.com  Tue Dec 22 14:24:29 2009
From: sean at seanmcollins.com (Sean Collins)
Date: Tue, 22 Dec 2009 09:24:29 -0500
Subject: [EMBOSS] EMBOSS amd64 packages
Message-ID: <96FA7C41-3AED-403B-A9A7-56EA8603C049@seanmcollins.com>

Hello,

I have built amd64 packages of the latest stable EMBOSS  
(emboss.sourceforge.net) release for CentOS 5.4 and would like to  
share them with the community. I have spec files, SRPMS and RPMs.

Thank You,
Sean Collins



From belegdol at gmail.com  Tue Dec 22 19:59:45 2009
From: belegdol at gmail.com (Julian Sikorski)
Date: Tue, 22 Dec 2009 20:59:45 +0100
Subject: [EMBOSS] EMBOSS amd64 packages
In-Reply-To: <96FA7C41-3AED-403B-A9A7-56EA8603C049@seanmcollins.com>
References: <96FA7C41-3AED-403B-A9A7-56EA8603C049@seanmcollins.com>
Message-ID: <hgr8fg$c3g$1@ger.gmane.org>

W dniu 22.12.2009 15:24, Sean Collins pisze:
> Hello,
> 
> I have built amd64 packages of the latest stable EMBOSS
> (emboss.sourceforge.net) release for CentOS 5.4 and would like to share
> them with the community. I have spec files, SRPMS and RPMs.
> 
> Thank You,
> Sean Collins
Hi,

I package EMBOSS for Fedora. Did you create your spec files from
scratch, or did you use mine as a basis? Maybe we could join forces and
you could co-maintain emboss in the EL branch? Are you a Fedora packager?

Julian



From sean at seanmcollins.com  Tue Dec 22 20:38:43 2009
From: sean at seanmcollins.com (Sean Collins)
Date: Tue, 22 Dec 2009 15:38:43 -0500
Subject: [EMBOSS] EMBOSS amd64 packages
In-Reply-To: <hgr8fg$c3g$1@ger.gmane.org>
References: <96FA7C41-3AED-403B-A9A7-56EA8603C049@seanmcollins.com>
	<hgr8fg$c3g$1@ger.gmane.org>
Message-ID: <8A6FFA1B-DE98-41C6-88AD-09AE1150F935@seanmcollins.com>

Hi Julian, pleasure to speak with you.

On Dec 22, 2009, at 2:59 PM, Julian Sikorski wrote:

> I package EMBOSS for Fedora. Did you create your spec files from
> scratch, or did you use mine as a basis?

I extracted spec files from the Emboss 5.0.0 RPM on the emboss site,  
which has Ryan Golhar <golharam at umdnj.edu> listed in the %changelog  
section.

> Maybe we could join forces and
> you could co-maintain emboss in the EL branch? Are you a Fedora  
> packager?

I am not a Fedora packager but would be happy to become one to  
maintain an EL/EPEL branch of EMBOSS.

Thank You,
Sean Collins