From benys at usp.br Mon Sep 1 11:04:28 2008 From: benys at usp.br (Beny Spira) Date: Mon, 1 Sep 2008 12:04:28 -0300 Subject: [EMBOSS] jemboss In-Reply-To: <20080830015014.GB19735@kunpuu.plessy.org> References: <21e884180808281625m6f6fde4ci2932ed82a202c642@mail.gmail.com> <55740.86.9.126.186.1219996803.squirrel@webmail.ebi.ac.uk> <20080829090845.GG15089@kunpuu.plessy.org> <21e884180808290821r4da88fc7p542568a6e3589760@mail.gmail.com> <20080830015014.GB19735@kunpuu.plessy.org> Message-ID: <21e884180809010804p34882dc2g9b0097162ff68f2e@mail.gmail.com> Thanks Charles I've installed Sun's jdk and pointed the path as you recommended, but the install program jut ignored it. It kept asking where java is installed, and when pointed to /usr/lib/jvm/java- > > 6-sun-1.6.0.07/include or to usr/lib/jvm/java-6-sun-1.6.0.07/include/linux > it did not accept it. > I am not sure about which java is installed by default in Debian, as there appears to be more than one (gcj, eclipse and now sun's jre and jdk). Is there anything else that may be done to install Jemboss? Beny Le Fri, Aug 29, 2008 at 12:21:43PM -0300, Beny Spira a ?crit : > > Thanks for the answers. The libgd2-devel package was indeed missing. I > > installed libgd2-xpm-dev and jemboss installation went smoothly. > > However, I can't run jemboss, there is no response to the command > > ./runJemboss.sh > > I checked the permissions and it is OK. > > I even installed the entire EMBOSS package again, but still cannot make > it > > work. > > Any clue what might be wrong? > > Maybe you forgot to give the path to the jdk when calling the configure > script? > > If you use the non-free Sun Java package distributed by Debian (Lenny > release), the following option should do the job: > > --with-java=/usr/lib/jvm/java-6-sun-1.6.0.07/include > --with-javaos=/usr/lib/jvm/java-6-sun-1.6.0.07/include/linux > > The freed version of Sun Java is unfortunately not ready yet, and I do > not know if jemboss works with alternatives (gcj, ...). If it were so, > please contact me, and I will make an official jemboss package for > Debian. If not, we will have to wait for "IcedTea" to be ready. > > Have a nice day, > > -- > Charles Plessy > Debian Med packaging team, > Tsurumi, Kanagawa, Japan > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > -- Beny Spira Departamento de Microbiologia Instituto de Ci?ncias Biom?dicas Universidade de S?o Paulo Av. Prof. Lineu Prestes 1374 S?o Paulo-SP CEP:05508-900 Brasil Tel: 5511-3091-7347 FAX: 5511-3091-7354 E-mail: benys at usp.br Homepage: www.icb.usp.br/~benys From simon.andrews at bbsrc.ac.uk Mon Sep 8 03:34:30 2008 From: simon.andrews at bbsrc.ac.uk (simon andrews (BI)) Date: Mon, 8 Sep 2008 08:34:30 +0100 Subject: [EMBOSS] Illegal character warnings in uniprot Message-ID: Our regular update of uniprot threw up some warnings when we updated over the weekend. It's not clear from the error which line in the entry is problematic, but it doesn't seem to have caused any major problems and I can still retrieve and query the sequences from the indices created. We're still on EMBOSS v4 (I know I should update - but it works for what we use it for!). Is this something which is fixed in later versions or is it something new in uniprot itself? I'll paste in a couple of the 174 warnings I got. Cheers Simon. [formatdb] WARNING: Sequence number 176991 (lcl|MTBB1_METBF), 1 illegal character was removed: 1 - [formatdb] WARNING: Sequence number 176992 (lcl|MTBB1_METMA), 1 illegal character was removed: 1 - [formatdb] WARNING: Sequence number 176993 (lcl|MTBB2_METAC), 1 illegal character was removed: 1 - From isabelle.wells at roche.com Mon Sep 8 04:06:30 2008 From: isabelle.wells at roche.com (Wells, Isabelle) Date: Mon, 8 Sep 2008 10:06:30 +0200 Subject: [EMBOSS] Illegal character warnings in uniprot In-Reply-To: References: Message-ID: Hi, These errors are due to the non standard amino acid pyrrolysine O. I've been getting them for a couple months. I am not sure whether this was fixed in the later versions of EMBOSS, we are still on v4 as well. Best regards, Isabelle -----Original Message----- From: emboss-bounces at lists.open-bio.org [mailto:emboss-bounces at lists.open-bio.org] On Behalf Of simon andrews (BI) Sent: Monday, September 08, 2008 09:35 To: emboss at emboss.open-bio.org Subject: [EMBOSS] Illegal character warnings in uniprot Our regular update of uniprot threw up some warnings when we updated over the weekend. It's not clear from the error which line in the entry is problematic, but it doesn't seem to have caused any major problems and I can still retrieve and query the sequences from the indices created. We're still on EMBOSS v4 (I know I should update - but it works for what we use it for!). Is this something which is fixed in later versions or is it something new in uniprot itself? I'll paste in a couple of the 174 warnings I got. Cheers Simon. [formatdb] WARNING: Sequence number 176991 (lcl|MTBB1_METBF), 1 illegal character was removed: 1 - [formatdb] WARNING: Sequence number 176992 (lcl|MTBB1_METMA), 1 illegal character was removed: 1 - [formatdb] WARNING: Sequence number 176993 (lcl|MTBB2_METAC), 1 illegal character was removed: 1 - _______________________________________________ EMBOSS mailing list EMBOSS at lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/emboss From ajb at ebi.ac.uk Mon Sep 8 06:18:06 2008 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Mon, 8 Sep 2008 11:18:06 +0100 (BST) Subject: [EMBOSS] Illegal character warnings in uniprot In-Reply-To: References: Message-ID: <34807.86.9.126.186.1220869086.squirrel@webmail.ebi.ac.uk> Hi Simon, EMBOSS 6.0.1 no longer replaces pyrrolysine with a gap (neither did a fully patched 5.0.0 AFAIR). Thanks to Isabelle for the memory jog/hint. Alan > Our regular update of uniprot threw up some warnings when we updated > over the weekend. It's not clear from the error which line in the entry > is problematic, but it doesn't seem to have caused any major problems > and I can still retrieve and query the sequences from the indices > created. > > We're still on EMBOSS v4 (I know I should update - but it works for what > we use it for!). Is this something which is fixed in later versions or > is it something new in uniprot itself? > > I'll paste in a couple of the 174 warnings I got. > > Cheers > > Simon. > > [formatdb] WARNING: Sequence number 176991 (lcl|MTBB1_METBF), 1 illegal > character was removed: > 1 - > > [formatdb] WARNING: Sequence number 176992 (lcl|MTBB1_METMA), 1 illegal > character was removed: > 1 - > > [formatdb] WARNING: Sequence number 176993 (lcl|MTBB2_METAC), 1 illegal > character was removed: > 1 - > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From simon.andrews at bbsrc.ac.uk Mon Sep 8 07:06:59 2008 From: simon.andrews at bbsrc.ac.uk (simon andrews (BI)) Date: Mon, 8 Sep 2008 12:06:59 +0100 Subject: [EMBOSS] Illegal character warnings in uniprot In-Reply-To: <34807.86.9.126.186.1220869086.squirrel@webmail.ebi.ac.uk> References: <34807.86.9.126.186.1220869086.squirrel@webmail.ebi.ac.uk> Message-ID: OK thanks. Guess I've found an excuse to upgrade at last... Cheers Simon. > -----Original Message----- > From: ajb at ebi.ac.uk [mailto:ajb at ebi.ac.uk] > Sent: 08 September 2008 11:18 > To: simon andrews (BI) > Cc: emboss at emboss.open-bio.org > Subject: Re: [EMBOSS] Illegal character warnings in uniprot > > Hi Simon, > > EMBOSS 6.0.1 no longer replaces pyrrolysine with a gap > (neither did a fully patched 5.0.0 AFAIR). > Thanks to Isabelle for the memory jog/hint. > > Alan > > > > Our regular update of uniprot threw up some warnings when > we updated > > over the weekend. It's not clear from the error which line in the > > entry is problematic, but it doesn't seem to have caused any major > > problems and I can still retrieve and query the sequences from the > > indices created. > > > > We're still on EMBOSS v4 (I know I should update - but it works for > > what we use it for!). Is this something which is fixed in later > > versions or is it something new in uniprot itself? > > > > I'll paste in a couple of the 174 warnings I got. > > > > Cheers > > > > Simon. > > > > [formatdb] WARNING: Sequence number 176991 (lcl|MTBB1_METBF), 1 > > illegal character was removed: > > 1 - > > > > [formatdb] WARNING: Sequence number 176992 (lcl|MTBB1_METMA), 1 > > illegal character was removed: > > 1 - > > > > [formatdb] WARNING: Sequence number 176993 (lcl|MTBB2_METAC), 1 > > illegal character was removed: > > 1 - > > > > _______________________________________________ > > EMBOSS mailing list > > EMBOSS at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/emboss > > > > > From gbottu at vub.ac.be Mon Sep 8 09:00:02 2008 From: gbottu at vub.ac.be (Guy Bottu) Date: Mon, 08 Sep 2008 15:00:02 +0200 Subject: [EMBOSS] Who is still using EMBOSS 3 ? Message-ID: <48C521D2.7080605@vub.ac.be> Dear all, I am considering upgrading the function names in locally developed programs to the names in EMBOSS version 4, in order to get rid of those annoying compiler warnings. This would make the wrappers4EMBOSS suite we distribute backward incompatible with EMBOSS version 3. Hence, is still someone using it ? Regards, Guy Bottu, BEN From uludag at ebi.ac.uk Tue Sep 9 06:54:38 2008 From: uludag at ebi.ac.uk (Mahmut Uludag) Date: Tue, 09 Sep 2008 11:54:38 +0100 Subject: [EMBOSS] jemboss In-Reply-To: <21e884180809010804p34882dc2g9b0097162ff68f2e@mail.gmail.com> References: <21e884180808281625m6f6fde4ci2932ed82a202c642@mail.gmail.com> <55740.86.9.126.186.1219996803.squirrel@webmail.ebi.ac.uk> <20080829090845.GG15089@kunpuu.plessy.org> <21e884180808290821r4da88fc7p542568a6e3589760@mail.gmail.com> <20080830015014.GB19735@kunpuu.plessy.org> <21e884180809010804p34882dc2g9b0097162ff68f2e@mail.gmail.com> Message-ID: <1220957678.9010.42.camel@emboss2.ebi.ac.uk> Hi Beny, > ... install program jut ignored it. It kept asking where java is installed, and > when pointed to /usr/lib/jvm/java-6-sun-1.6.0.07/include or to usr/lib/jvm/java-6-sun-1.6.0.07/include/linux > it did not accept it. You should normally enter the root directory of your Java installation when the jemboss install script prompts "Enter java location". In your case the answer to the prompt should probably be "/usr/lib/jvm/java-6-sun-1.6.0.07". Regards, Mahmut From benys at usp.br Tue Sep 9 11:18:08 2008 From: benys at usp.br (Beny Spira) Date: Tue, 9 Sep 2008 12:18:08 -0300 Subject: [EMBOSS] jemboss In-Reply-To: <1220957678.9010.42.camel@emboss2.ebi.ac.uk> References: <21e884180808281625m6f6fde4ci2932ed82a202c642@mail.gmail.com> <55740.86.9.126.186.1219996803.squirrel@webmail.ebi.ac.uk> <20080829090845.GG15089@kunpuu.plessy.org> <21e884180808290821r4da88fc7p542568a6e3589760@mail.gmail.com> <20080830015014.GB19735@kunpuu.plessy.org> <21e884180809010804p34882dc2g9b0097162ff68f2e@mail.gmail.com> <1220957678.9010.42.camel@emboss2.ebi.ac.uk> Message-ID: <21e884180809090818w2bc787cm4581c14be1c235b1@mail.gmail.com> Hi Mahmut It was that simple! Thank you, Beny Hi Beny, > > > ... install program jut ignored it. It kept asking where java is > installed, and > > when pointed to /usr/lib/jvm/java-6-sun-1.6.0.07/include or to > usr/lib/jvm/java-6-sun-1.6.0.07/include/linux > > it did not accept it. > > You should normally enter the root directory of your Java installation > when the jemboss install script prompts "Enter java location". In your > case the answer to the prompt should probably be > "/usr/lib/jvm/java-6-sun-1.6.0.07". > > Regards, > Mahmut > > > -- Beny Spira Departamento de Microbiologia Instituto de Ci?ncias Biom?dicas Universidade de S?o Paulo Av. Prof. Lineu Prestes 1374 S?o Paulo-SP CEP:05508-900 Brasil Tel: 5511-3091-7347 FAX: 5511-3091-7354 E-mail: benys at usp.br Homepage: www.icb.usp.br/~benys From bushel at niehs.nih.gov Fri Sep 12 11:45:03 2008 From: bushel at niehs.nih.gov (Bushel, Pierre (NIH/NIEHS) [E]) Date: Fri, 12 Sep 2008 11:45:03 -0400 Subject: [EMBOSS] RepeatMaker Message-ID: Greetings, Is RepeatMasker an application available through EMBOSS? If so, which version of RepeatMasker and of EMBOSS? Thanks, Pierre From pmr at ebi.ac.uk Fri Sep 12 17:36:40 2008 From: pmr at ebi.ac.uk (Peter Rice) Date: Fri, 12 Sep 2008 22:36:40 +0100 Subject: [EMBOSS] RepeatMaker In-Reply-To: References: Message-ID: <48CAE0E8.5050901@ebi.ac.uk> Bushel, Pierre (NIH/NIEHS) [E] wrote: > Is RepeatMasker an application available through EMBOSS? If so, which > version of RepeatMasker and of EMBOSS? No, but we can wrap it as an EMBASSY package if there is interest (this means providing an EMBOSS stabdard interface, but users will still need to install repeatmasker) regards, Peter Rice From jeedward at yahoo.com Sun Sep 21 13:14:10 2008 From: jeedward at yahoo.com (Ed) Date: Sun, 21 Sep 2008 10:14:10 -0700 (PDT) Subject: [EMBOSS] IICAI-09 Call for papers Message-ID: <528463.53941.qm@web45909.mail.sp1.yahoo.com> Dear Colleagues ? ? The 4th Indian International Conference on Artificial Intelligence (IICAI-09) will be held in Tumkur (near Bangalore), India during December 16-18 2009. The conference consists of paper presentations, special workshops, sessions, invited talks and local tours, etc.? and it is one of the biggest AI events in the world. We invite draft paper submissions. Please see the website: www.iiconference.org ?for more details of the conference. ? Sincerely ? ? Edward Publicity Committee From simon.andrews at bbsrc.ac.uk Mon Sep 22 06:52:15 2008 From: simon.andrews at bbsrc.ac.uk (simon andrews (BI)) Date: Mon, 22 Sep 2008 11:52:15 +0100 Subject: [EMBOSS] Prettyplot options Message-ID: I've been trying to make a nice image of an alignment using prettyplot, but have failed to find the right set of options to get what I want. I need to get the whole alignment into one image (png), even if that ends up being very long and thin. At the moment it always seems to paginate. I also need to get rid of all the text on the plot (including the program name and the list of options etc.). I've tried all of the -gtitle -gsubtitle etc options, but there is some text I can't seem to shift. At a push I could get away with fixing either one of those two problems as I can then fix the other myself, but the combination of the two is making life difficult. Is there an option I'm missing or is this not possible with prettyplot? The nearest I got was: cat muscle.txt | prettyplot -graph png -nonumber -noname -consensus N -auto -sequences stdin -goutfile pretty.png -gdesc " " -gtitle " " -gsubtitle " " Cheers Simon. -- Simon Andrews PhD Bioinformatics Group The Babraham Institute simon.andrews at bbsrc.ac.uk +44 (0) 1223 496463 From pmr at ebi.ac.uk Mon Sep 22 07:53:55 2008 From: pmr at ebi.ac.uk (Peter Rice) Date: Mon, 22 Sep 2008 12:53:55 +0100 Subject: [EMBOSS] Prettyplot options In-Reply-To: References: Message-ID: <48D78753.4090808@ebi.ac.uk> simon andrews (BI) wrote: > I've been trying to make a nice image of an alignment using prettyplot, > but have failed to find the right set of options to get what I want. > > I need to get the whole alignment into one image (png), even if that > ends up being very long and thin. At the moment it always seems to > paginate. An interesting challenge. I will take a look. We were limited by the graphics library when we first rewrote prettyplot for EMBOSS but we now have more reliable PNG options in plplot. Pretyplot scales the plot to fit the page, so you need extra options to make the page larger ... and I will make sure all titles and labels can be hidden. regards, Peter From simon.andrews at bbsrc.ac.uk Mon Sep 22 08:12:50 2008 From: simon.andrews at bbsrc.ac.uk (simon andrews (BI)) Date: Mon, 22 Sep 2008 13:12:50 +0100 Subject: [EMBOSS] Prettyplot options In-Reply-To: <48D79109.6F09.00E0.0@dundee.ac.uk> References: <48D79109.6F09.00E0.0@dundee.ac.uk> Message-ID: > -----Original Message----- > From: David Martin [mailto:d.m.a.martin at dundee.ac.uk] > Sent: 22 September 2008 12:35 > To: simon andrews (BI) > Subject: Re: [EMBOSS] Prettyplot options > > Might I be heretical and suggest you try Jalview for this? That would be OK for a single plot, but I'm trying to make this part of a pipeline so I need to generate these figures programatically, which I don't think is an option with Jalview (at least I've never used it that way). Peter: many thanks for looking at this. Anything you can do would be much appreciated. TTFN Simon. From david.bauer at bayerhealthcare.com Mon Sep 22 08:10:04 2008 From: david.bauer at bayerhealthcare.com (david.bauer at bayerhealthcare.com) Date: Mon, 22 Sep 2008 14:10:04 +0200 Subject: [EMBOSS] Prettyplot options In-Reply-To: Message-ID: Hi, emboss-bounces at lists.open-bio.org schrieb am 22/09/2008 12:52:15: > I've been trying to make a nice image of an alignment using prettyplot, > but have failed to find the right set of options to get what I want. > > I need to get the whole alignment into one image (png), even if that > ends up being very long and thin. At the moment it always seems to > paginate. experiment with the option -residuesperline. If you set this large enough, you can squeeze the alignment to one page or even one row. > > I also need to get rid of all the text on the plot (including the > program name and the list of options etc.). I've tried all of the > -gtitle -gsubtitle etc options, but there is some text I can't seem to > shift. with -nolist you can remove the run options which appear at the bottom of the plot. But I have no idea how to remove the gtitle and gsubtitle completely. > > At a push I could get away with fixing either one of those two problems > as I can then fix the other myself, but the combination of the two is > making life difficult. > > Is there an option I'm missing or is this not possible with prettyplot? > > The nearest I got was: > > cat muscle.txt | prettyplot -graph png -nonumber -noname -consensus N > -auto -sequences stdin -goutfile pretty.png -gdesc " " -gtitle " " > -gsubtitle " " > > Cheers > > Simon. > > -- > Simon Andrews PhD > Bioinformatics Group > The Babraham Institute > > simon.andrews at bbsrc.ac.uk > +44 (0) 1223 496463 > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss Cheers, David. From tjc at sanger.ac.uk Mon Sep 22 08:53:52 2008 From: tjc at sanger.ac.uk (Tim Carver) Date: Mon, 22 Sep 2008 13:53:52 +0100 Subject: [EMBOSS] Prettyplot options In-Reply-To: <48D78753.4090808@ebi.ac.uk> Message-ID: You could try the Jemboss alignment editor. http://emboss.sourceforge.net/Jemboss/ This does create a single page and you can run it from the command line: http://emboss.sourceforge.net/Jemboss/jae.html#Command Regards Tim On 22/9/08 12:53, "Peter Rice" wrote: > simon andrews (BI) wrote: >> I've been trying to make a nice image of an alignment using prettyplot, >> but have failed to find the right set of options to get what I want. >> >> I need to get the whole alignment into one image (png), even if that >> ends up being very long and thin. At the moment it always seems to >> paginate. > > An interesting challenge. I will take a look. > > We were limited by the graphics library when we first rewrote prettyplot > for EMBOSS but we now have more reliable PNG options in plplot. > > Pretyplot scales the plot to fit the page, so you need extra options to > make the page larger ... and I will make sure all titles and labels can > be hidden. > > regards, > > Peter > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss -- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in England with number 1021457 and a company registered in England with number 2742969, whose registered office is 215 Euston Road, London, NW1 2BE. From pmr at ebi.ac.uk Mon Sep 22 10:24:36 2008 From: pmr at ebi.ac.uk (Peter Rice) Date: Mon, 22 Sep 2008 15:24:36 +0100 Subject: [EMBOSS] Prettyplot options In-Reply-To: References: Message-ID: <48D7AAA4.4060906@ebi.ac.uk> simon andrews (BI) wrote: > The nearest I got was: > > cat muscle.txt | prettyplot -graph png -nonumber -noname -consensus N > -auto -sequences stdin -goutfile pretty.png -gdesc " " -gtitle " " > -gsubtitle " " Without going into details .... -nolistoptions removes the command options at the bottom Using two spaces for the gdesc and gtitle values removes them -gsubtitle " " (two spaces again) removes the date. We will look into why two spaces were needed, and add an easier option to remove all text. We will also look into generating larger PNG files for large alignments. Hope this helps Peter From simon.andrews at bbsrc.ac.uk Mon Sep 22 10:28:20 2008 From: simon.andrews at bbsrc.ac.uk (simon andrews (BI)) Date: Mon, 22 Sep 2008 15:28:20 +0100 Subject: [EMBOSS] Prettyplot options In-Reply-To: <48D7AAA4.4060906@ebi.ac.uk> References: <48D7AAA4.4060906@ebi.ac.uk> Message-ID: > -----Original Message----- > From: Peter Rice [mailto:pmr at ebi.ac.uk] > Sent: 22 September 2008 15:25 > To: simon andrews (BI) > Cc: emboss at emboss.open-bio.org > Subject: Re: [EMBOSS] Prettyplot options > > simon andrews (BI) wrote: > > The nearest I got was: > > > > cat muscle.txt | prettyplot -graph png -nonumber -noname > -consensus N > > -auto -sequences stdin -goutfile pretty.png -gdesc " " -gtitle " " > > -gsubtitle " " > > Without going into details .... > > -nolistoptions removes the command options at the bottom > > Using two spaces for the gdesc and gtitle values removes them > > -gsubtitle " " (two spaces again) removes the date. Excellent. That will do for my purposes at the moment. I can composite the different files together myself once the text has gone. Many thanks Simon. From michael.watson at bbsrc.ac.uk Tue Sep 23 06:58:10 2008 From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C)) Date: Tue, 23 Sep 2008 11:58:10 +0100 Subject: [EMBOSS] New and confusing problem with infoseq! Message-ID: <8975119BCD0AC5419D61A9CF1A923E9506D87D29@iahce2ksrv1.iah.bbsrc.ac.uk> Confusing because this didn't happen before and I haven't changed anything! EMBOSS 5.0.0 on RHEL 4. Why is infoseq complaining about a database? Has my environment changed because this used to work exactly how I wanted it to! Mick -bash-3.00$ infoseq Displays some simple information about sequences Input (gapped) sequence(s): Contig0.1399.fasta Died: Qualifier '-database' not found -bash-3.00$ more Contig0.1399.fasta >lcl|Contig0.1399 No definition line found AGAGGAGAGGAGAGGACAAAATATGTTATTCCTTGGCAAGTGTTCCCTTGAGAAGGTGTCTGTTAGGGCACA GTCCATTG GTGCCTGTGAGGAAAAAGAAGCTGAAGGACTTACTGGGCCACACAGTTGCGACCATCAGAGCTGCCAGCAGC AGCATGTT TGCTGCTCCAGCTCAGCTGCTGCTGAGACTCAGAGATGTGTGAGTGAGGCCCCAGATGGGGACATACTGAGT AGGAGGAG CTGTCCCCAGCAGTGTTTTTTTTTCTGTGCATAACACCATGGGGCTGTGCTTGTCAAGACGTTACAGCAACC CGGGAAAT AAGCAAGACCAGAGAATGCTGAGGTTGTTTTGAAGGAGGTGGTCCTGTCTGCTTTCCTGAGAAATGCAAAGA ACCGTTGC TCAGTCCAAGGACTGAAAGGCATGAAGGCTCTTCCAACACAAGCTGTGTTCAGAGCCTCGCAAAACCAGCAC TATGGAAA From ajb at ebi.ac.uk Tue Sep 23 08:29:26 2008 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Tue, 23 Sep 2008 13:29:26 +0100 (BST) Subject: [EMBOSS] New and confusing problem with infoseq! In-Reply-To: <8975119BCD0AC5419D61A9CF1A923E9506D87D29@iahce2ksrv1.iah.bbsrc.ac.uk> References: <8975119BCD0AC5419D61A9CF1A923E9506D87D29@iahce2ksrv1.iah.bbsrc.ac.uk> Message-ID: <55455.86.9.126.186.1222172966.squirrel@webmail.ebi.ac.uk> Hello Mick, The -database qualifier was added to infoseq in EMBOSS-5.0.0. The error you're getting would, for example, happen if your EMBOSS 5.0.0 infoseq executable was reading an EMBOSS 4.x.x infoseq.acd file. That could happen if you had set the EMBOSS_ACDROOT environment variable to point to an old ACD directory or, similarly, set an emboss_acdroot in your .embossrc or emboss.default file. For most simple EMBOSS installations you shouldn't need to set EMBOSS_ACDROOT (or equivalent) at all. HTH Alan > Confusing because this didn't happen before and I haven't changed > anything! > > EMBOSS 5.0.0 on RHEL 4. > > Why is infoseq complaining about a database? Has my environment changed > because this used to work exactly how I wanted it to! > > Mick > > -bash-3.00$ infoseq > Displays some simple information about sequences > Input (gapped) sequence(s): Contig0.1399.fasta > Died: Qualifier '-database' not found > > -bash-3.00$ more Contig0.1399.fasta >>lcl|Contig0.1399 No definition line found > AGAGGAGAGGAGAGGACAAAATATGTTATTCCTTGGCAAGTGTTCCCTTGAGAAGGTGTCTGTTAGGGCACA > GTCCATTG > GTGCCTGTGAGGAAAAAGAAGCTGAAGGACTTACTGGGCCACACAGTTGCGACCATCAGAGCTGCCAGCAGC > AGCATGTT > TGCTGCTCCAGCTCAGCTGCTGCTGAGACTCAGAGATGTGTGAGTGAGGCCCCAGATGGGGACATACTGAGT > AGGAGGAG > CTGTCCCCAGCAGTGTTTTTTTTTCTGTGCATAACACCATGGGGCTGTGCTTGTCAAGACGTTACAGCAACC > CGGGAAAT > AAGCAAGACCAGAGAATGCTGAGGTTGTTTTGAAGGAGGTGGTCCTGTCTGCTTTCCTGAGAAATGCAAAGA > ACCGTTGC > TCAGTCCAAGGACTGAAAGGCATGAAGGCTCTTCCAACACAAGCTGTGTTCAGAGCCTCGCAAAACCAGCAC > TATGGAAA > > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From michael.watson at bbsrc.ac.uk Tue Sep 23 08:33:51 2008 From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C)) Date: Tue, 23 Sep 2008 13:33:51 +0100 Subject: [EMBOSS] New and confusing problem with infoseq! In-Reply-To: <55455.86.9.126.186.1222172966.squirrel@webmail.ebi.ac.uk> References: <8975119BCD0AC5419D61A9CF1A923E9506D87D29@iahce2ksrv1.iah.bbsrc.ac.uk> <55455.86.9.126.186.1222172966.squirrel@webmail.ebi.ac.uk> Message-ID: <8975119BCD0AC5419D61A9CF1A923E9506D87D2F@iahce2ksrv1.iah.bbsrc.ac.uk> Thanks for the reply! I did indeed set my ACD root, and I seem to recall I did that because my EMBOSS applications were trying to access acd files in the unpack directory I installed from rather than the install directory I installed to. This seemed to work. However, you are right, my EMBOSS_ACDROOT variable has been hijacked by a 3rd party app - grrr!! -----Original Message----- From: ajb at ebi.ac.uk [mailto:ajb at ebi.ac.uk] Sent: 23 September 2008 13:29 To: michael watson (IAH-C) Cc: emboss at lists.open-bio.org Subject: Re: [EMBOSS] New and confusing problem with infoseq! Hello Mick, The -database qualifier was added to infoseq in EMBOSS-5.0.0. The error you're getting would, for example, happen if your EMBOSS 5.0.0 infoseq executable was reading an EMBOSS 4.x.x infoseq.acd file. That could happen if you had set the EMBOSS_ACDROOT environment variable to point to an old ACD directory or, similarly, set an emboss_acdroot in your .embossrc or emboss.default file. For most simple EMBOSS installations you shouldn't need to set EMBOSS_ACDROOT (or equivalent) at all. HTH Alan > Confusing because this didn't happen before and I haven't changed > anything! > > EMBOSS 5.0.0 on RHEL 4. > > Why is infoseq complaining about a database? Has my environment changed > because this used to work exactly how I wanted it to! > > Mick > > -bash-3.00$ infoseq > Displays some simple information about sequences > Input (gapped) sequence(s): Contig0.1399.fasta > Died: Qualifier '-database' not found > > -bash-3.00$ more Contig0.1399.fasta >>lcl|Contig0.1399 No definition line found > AGAGGAGAGGAGAGGACAAAATATGTTATTCCTTGGCAAGTGTTCCCTTGAGAAGGTGTCTGTTAGGGCACA > GTCCATTG > GTGCCTGTGAGGAAAAAGAAGCTGAAGGACTTACTGGGCCACACAGTTGCGACCATCAGAGCTGCCAGCAGC > AGCATGTT > TGCTGCTCCAGCTCAGCTGCTGCTGAGACTCAGAGATGTGTGAGTGAGGCCCCAGATGGGGACATACTGAGT > AGGAGGAG > CTGTCCCCAGCAGTGTTTTTTTTTCTGTGCATAACACCATGGGGCTGTGCTTGTCAAGACGTTACAGCAACC > CGGGAAAT > AAGCAAGACCAGAGAATGCTGAGGTTGTTTTGAAGGAGGTGGTCCTGTCTGCTTTCCTGAGAAATGCAAAGA > ACCGTTGC > TCAGTCCAAGGACTGAAAGGCATGAAGGCTCTTCCAACACAAGCTGTGTTCAGAGCCTCGCAAAACCAGCAC > TATGGAAA > > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From pmr at ebi.ac.uk Tue Sep 23 08:34:48 2008 From: pmr at ebi.ac.uk (Peter Rice) Date: Tue, 23 Sep 2008 13:34:48 +0100 Subject: [EMBOSS] New and confusing problem with infoseq! In-Reply-To: <8975119BCD0AC5419D61A9CF1A923E9506D87D29@iahce2ksrv1.iah.bbsrc.ac.uk> References: <8975119BCD0AC5419D61A9CF1A923E9506D87D29@iahce2ksrv1.iah.bbsrc.ac.uk> Message-ID: <48D8E268.4080108@ebi.ac.uk> michael watson (IAH-C) wrote: > Confusing because this didn't happen before and I haven't changed > anything! > > EMBOSS 5.0.0 on RHEL 4. > > Why is infoseq complaining about a database? Has my environment changed > because this used to work exactly how I wanted it to! > > Mick > > -bash-3.00$ infoseq > Displays some simple information about sequences > Input (gapped) sequence(s): Contig0.1399.fasta > Died: Qualifier '-database' not found Yes, your environment has changed. EMBOSS 5.0.0 does have a -database qualifier, but the infoseq.acd file that was used does not have one. The -database qualifier was new in 5.0.0 and controls whether the database column appears in the output. If you run infoseq with the command line option -debug it will write a file infoseq.dbg that will include the full path the the infoseq.acd file that it used. If you need more help working out why the wrong file is used, please send the infoseq.dbg file to emboss-bug at emboss.open-bio.org and we will try to help. regards, Peter Rice From pmr at ebi.ac.uk Tue Sep 23 08:52:40 2008 From: pmr at ebi.ac.uk (Peter Rice) Date: Tue, 23 Sep 2008 13:52:40 +0100 Subject: [EMBOSS] New and confusing problem with infoseq! In-Reply-To: <8975119BCD0AC5419D61A9CF1A923E9506D87D2F@iahce2ksrv1.iah.bbsrc.ac.uk> References: <8975119BCD0AC5419D61A9CF1A923E9506D87D29@iahce2ksrv1.iah.bbsrc.ac.uk> <55455.86.9.126.186.1222172966.squirrel@webmail.ebi.ac.uk> <8975119BCD0AC5419D61A9CF1A923E9506D87D2F@iahce2ksrv1.iah.bbsrc.ac.uk> Message-ID: <48D8E698.70309@ebi.ac.uk> michael watson (IAH-C) wrote: > Thanks for the reply! > > I did indeed set my ACD root, and I seem to recall I did that because my > EMBOSS applications were trying to access acd files in the unpack > directory I installed from rather than the install directory I installed > to. This seemed to work. > > However, you are right, my EMBOSS_ACDROOT variable has been hijacked by > a 3rd party app - grrr!! I am curious ... which 3rd party application did this? Some interfaces set EMBOSS_ACDROOT or other variables but they should not affect running from the command line. regards, Peter