From lcarlo at cs.utah.edu Sat Mar 1 16:52:17 2008 From: lcarlo at cs.utah.edu (Lorena Carlo) Date: Sat, 01 Mar 2008 16:52:17 -0500 Subject: [EMBOSS] newbie, need some guidance with emboss web services Message-ID: <47C9D011.3000606@cs.utah.edu> Hi, I am trying to use EMBOSS web services in a python client. I use ZSI 2.1a library to communicate with the web services. I am trying to use edit.seqret.derived web service: (http://www.ebi.ac.uk/soaplab/emboss4/services/edit.seqret.derived?wsdl). I am sending the following sequence that I found in the EMBOSS tutorial: embl:xlrhodop to the web service. But I am not getting any answer. Bellow I am including some lines of code I am using. Can somebody give me any guidance with this?. Should I use the non derived ones, I prefer to use the derived ones, because the application have support for complex types. #This are the stub files that ZSI generates to manage complex types. from seqretService_client import * from seqretService_types import * #This are in the stub files and allow you to call the methods inside the web service loc = seqretServiceLocator() port = loc.getedit__seqret() req1 = createAndRunRequest() reqseqret1 = req1.new_seqret() reqsequence1 = reqseqret1.new_sequence() reqsequence1.set_element_sequence_usa('embl:xlrhodop') reqseqret1.Sequence = reqsequence1 req1.Seqret = reqseqret1 resp1 = port.createAndRun(req1) jobid = resp1.Jobid print jobid edit.seqret/-11701ee7:11864847959:3072 waitforReq = waitForRequest() waitforReq.set_element_jobid(jobid) resp2 = port.waitFor(waitforReq) reqresults = getResultsRequest() reqresults.set_element_jobid(jobid) response = port.getResults(reqresults) seqretresult = response.get_element_seqretResult() print seqretresult.get_element_report() None print seqretresult.get_element_outseq() None print seqretresult.get_element_detailed_status() None BTW: I have also used the runAndWaitFor method but I obtain the same result (None). Thanks! Lorena From lcarlo at cs.utah.edu Sat Mar 1 17:00:05 2008 From: lcarlo at cs.utah.edu (Lorena Carlo) Date: Sat, 01 Mar 2008 17:00:05 -0500 Subject: [EMBOSS] newbie, need some guidance with emboss web services Message-ID: <47C9D1E5.1050900@cs.utah.edu> Hi, I am trying to use EMBOSS web services in a python client. I use ZSI 2.1a library to communicate with the web services. I am trying to use edit.seqret.derived web service: (http://www.ebi.ac.uk/soaplab/emboss4/services/edit.seqret.derived?wsdl). I am sending the following sequence that I found in the EMBOSS tutorial: embl:xlrhodop to the web service. But I am not getting any answer. Bellow I am including some lines of code I am using. Can somebody give me any guidance with this?. Should I use the non derived ones, I prefer to use the derived ones, because the application have support for complex types. #This are the stub files that ZSI generates to manage complex types. from seqretService_client import * from seqretService_types import * #This are in the stub files and allow you to call the methods inside the web service loc = seqretServiceLocator() port = loc.getedit__seqret() req1 = createAndRunRequest() reqseqret1 = req1.new_seqret() reqsequence1 = reqseqret1.new_sequence() reqsequence1.set_element_sequence_usa('embl:xlrhodop') reqseqret1.Sequence = reqsequence1 req1.Seqret = reqseqret1 resp1 = port.createAndRun(req1) jobid = resp1.Jobid print jobid edit.seqret/-11701ee7:11864847959:3072 waitforReq = waitForRequest() waitforReq.set_element_jobid(jobid) resp2 = port.waitFor(waitforReq) reqresults = getResultsRequest() reqresults.set_element_jobid(jobid) response = port.getResults(reqresults) seqretresult = response.get_element_seqretResult() print seqretresult.get_element_report() None print seqretresult.get_element_outseq() None print seqretresult.get_element_detailed_status() None BTW: I have also used the runAndWaitFor method but I obtain the same result (None). Thanks! Lorena From lcarlo at cs.utah.edu Mon Mar 3 19:16:24 2008 From: lcarlo at cs.utah.edu (Lorena Carlo) Date: Mon, 03 Mar 2008 17:16:24 -0700 Subject: [EMBOSS] EMBOSS explorer is not working Message-ID: <47CC94D8.1070509@cs.utah.edu> Hi, I just wanted to let you know that EMBOSS explorer is not working. I tested seqret and prettyplot methods and I get the same message: "I can't run a live demo on the Sourceforge server. I hope to solve this problem soon". Please let me know when you fix it. Thanks, Lorena From uludag at ebi.ac.uk Tue Mar 4 11:57:12 2008 From: uludag at ebi.ac.uk (Mahmut Uludag) Date: Tue, 04 Mar 2008 16:57:12 +0000 Subject: [EMBOSS] newbie, need some guidance with emboss web services In-Reply-To: <47C9D011.3000606@cs.utah.edu> References: <47C9D011.3000606@cs.utah.edu> Message-ID: <1204649832.2439.27.camel@emboss2.ebi.ac.uk> Hi Lorena, I have used Eclipse TCP/IP-Monitor to check the data transfer between your client program and the Soaplab services. The correct server response to the getResults call is definitely received by the client program but I'm not able to find out why the attributes of the response object are empty in your client program. As you may have noticed I asked help from two colleagues that I know they have python webservices experience. If I hear anything from them then will let you know. Regards, Mahmut On Sat, 2008-03-01 at 16:52 -0500, Lorena Carlo wrote: > Hi, > > I am trying to use EMBOSS web services in a python client. I use ZSI > 2.1a library to communicate with the web services. I am trying to use > edit.seqret.derived web service: > (http://www.ebi.ac.uk/soaplab/emboss4/services/edit.seqret.derived?wsdl). > I am sending the following sequence that I found in the EMBOSS tutorial: > embl:xlrhodop to the web service. But I am not getting any answer. > Bellow I am including some lines of code I am using. Can somebody give > me any guidance with this?. Should I use the non derived ones, I > prefer to use the derived ones, because the application have support for > complex types. > > > > #This are the stub files that ZSI generates to manage complex types. > from seqretService_client import * > from seqretService_types import * > > #This are in the stub files and allow you to call the methods inside the > web service > loc = seqretServiceLocator() > port = loc.getedit__seqret() > > req1 = createAndRunRequest() > reqseqret1 = req1.new_seqret() > reqsequence1 = reqseqret1.new_sequence() > reqsequence1.set_element_sequence_usa('embl:xlrhodop') > reqseqret1.Sequence = reqsequence1 > req1.Seqret = reqseqret1 > resp1 = port.createAndRun(req1) > > jobid = resp1.Jobid > print jobid > edit.seqret/-11701ee7:11864847959:3072 > > waitforReq = waitForRequest() > waitforReq.set_element_jobid(jobid) > > resp2 = port.waitFor(waitforReq) > > reqresults = getResultsRequest() > reqresults.set_element_jobid(jobid) > response = port.getResults(reqresults) > seqretresult = response.get_element_seqretResult() > print seqretresult.get_element_report() > None > print seqretresult.get_element_outseq() > None > print seqretresult.get_element_detailed_status() > None > > BTW: I have also used the runAndWaitFor method but I obtain the same > result (None). > > Thanks! > > Lorena > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss From staffa at niehs.nih.gov Tue Mar 4 14:32:33 2008 From: staffa at niehs.nih.gov (Staffa, Nick (NIH/NIEHS)) Date: Tue, 04 Mar 2008 14:32:33 -0500 Subject: [EMBOSS] Jemboss In-Reply-To: <1204649832.2439.27.camel@emboss2.ebi.ac.uk> Message-ID: Does anyone out there use Jemboss? Must one always invoke a web URL to get it running every time he wants to use it? or is that just one way to set it up? Nick Staffa Telephone: 919-316-4569 (NIEHS: 6-4569) Scientific Computing Support Group NIEHS Information Technology Support Services Contract (Science Task Monitor: Roy W. Reter (reter at niehs.nih.gov) National Institute of Environmental Health Sciences National Institutes of Health Research Triangle Park, North Carolina From uludag at ebi.ac.uk Thu Mar 6 15:08:33 2008 From: uludag at ebi.ac.uk (uludag at ebi.ac.uk) Date: Thu, 6 Mar 2008 20:08:33 -0000 (GMT) Subject: [EMBOSS] newbie, need some guidance with emboss web services In-Reply-To: <1204649832.2439.27.camel@emboss2.ebi.ac.uk> References: <47C9D011.3000606@cs.utah.edu> <1204649832.2439.27.camel@emboss2.ebi.ac.uk> Message-ID: <37303.81.156.216.123.1204834113.squirrel@webmail.ebi.ac.uk> Hi Lorena, > As you may have noticed I asked help from two colleagues that I know > they have python webservices experience. If I hear anything from them > then will let you know. Jan Christan from The EMBRACE project suggested to check the output from the service using Soapui's output validation support. Soapui let to see a problem in the service output. This problem is now fixed and your test script now prints the service results correctly. Regards, Mahmut From lcarlo at cs.utah.edu Thu Mar 6 17:14:08 2008 From: lcarlo at cs.utah.edu (Lorena Carlo) Date: Thu, 06 Mar 2008 15:14:08 -0700 Subject: [EMBOSS] broken links for EMBOSS web services Message-ID: <47D06CB0.4050608@cs.utah.edu> Hello, There are problem with some links: http://www.ebi.ac.uk/soaplab/emboss4/servlet/AxisServlet and http://www.ebi.ac.uk/soaplab/emboss4/services/alignment_multiple.prettyplot.derived?wsdl, it think the problem is displaying the wsdl of the derived web services. * To see the available web services and their methods, I get the following error: And now... Some Services AXIS error Sorry, something seems to have gone wrong... here are the details: Fault - Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse AxisFault faultCode: {http://schemas.xmlsoap.org/soap/envelope/}Server.generalException faultSubcode: faultString: Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse faultActor: faultNode: faultDetail: {http://xml.apache.org/axis/}hostname:web57-node1.ebi.ac.uk * And the web services wsdl description have the following problem: AXIS error Sorry, something seems to have gone wrong... here are the details: Fault - Failed to determine deployed service names.; nested exception is: org.apache.axis.ConfigurationException: Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse AxisFault faultCode: {http://schemas.xmlsoap.org/soap/envelope/}Server.generalException faultSubcode: faultString: Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse faultActor: faultNode: faultDetail: {http://xml.apache.org/axis/}hostname:web57-node1.ebi.ac.uk Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse at org.apache.axis.providers.java.JavaProvider.getServiceClass(JavaProvider.java:432) at org.apache.axis.providers.java.JavaProvider.initServiceDesc(JavaProvider.java:461) at org.apache.axis.handlers.soap.SOAPService.getInitializedServiceDesc(SOAPService.java:286) at org.apache.axis.deployment.wsdd.WSDDService.makeNewInstance(WSDDService.java:500) at org.apache.axis.deployment.wsdd.WSDDDeployment.getDeployedServices(WSDDDeployment.java:503) at org.apache.axis.configuration.FileProvider.getDeployedServices(FileProvider.java:296) at org.apache.axis.transport.http.QSWSDLHandler.getDeployedServiceNames(QSWSDLHandler.java:218) at org.apache.axis.transport.http.QSWSDLHandler.updateSoapAddressLocationURLs(QSWSDLHandler.java:153) at org.apache.axis.transport.http.QSWSDLHandler.invoke(QSWSDLHandler.java:72) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.axis.transport.http.AxisServlet.processQuery(AxisServlet.java:1226) at org.apache.axis.transport.http.AxisServlet.doGet(AxisServlet.java:249) at javax.servlet.http.HttpServlet.service(HttpServlet.java:689) at org.apache.axis.transport.http.AxisServletBase.service(AxisServletBase.java:327) at javax.servlet.http.HttpServlet.service(HttpServlet.java:802) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:252) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:173) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:213) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:178) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:126) at org.apache.catalina.valves.ErrorReportValve.invoke(ErrorReportValve.java:105) at org.apache.catalina.core.StandardEngineValve.invoke(StandardEngineValve.java:107) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:148) at org.apache.jk.server.JkCoyoteHandler.invoke(JkCoyoteHandler.java:199) at org.apache.jk.common.HandlerRequest.invoke(HandlerRequest.java:282) at org.apache.jk.common.ChannelSocket.invoke(ChannelSocket.java:767) at org.apache.jk.common.ChannelSocket.processConnection(ChannelSocket.java:697) at org.apache.jk.common.ChannelSocket$SocketConnection.runIt(ChannelSocket.java:889) at org.apache.tomcat.util.threads.ThreadPool$ControlRunnable.run(ThreadPool.java:684) at java.lang.Thread.run(Thread.java:619) Caused by: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse at org.apache.catalina.loader.WebappClassLoader.loadClass(WebappClassLoader.java:1355) at org.apache.catalina.loader.WebappClassLoader.loadClass(WebappClassLoader.java:1201) at org.apache.axis.utils.ClassUtils$2.run(ClassUtils.java:187) at java.security.AccessController.doPrivileged(Native Method) at org.apache.axis.utils.ClassUtils.loadClass(ClassUtils.java:160) at org.apache.axis.utils.ClassUtils.forName(ClassUtils.java:142) at org.apache.axis.utils.cache.ClassCache.lookup(ClassCache.java:85) at org.apache.axis.providers.java.JavaProvider.getServiceClass(JavaProvider.java:428) ... 32 more org.apache.axis.ConfigurationException: Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse AxisFault faultCode: {http://schemas.xmlsoap.org/soap/envelope/}Server.generalException faultSubcode: faultString: Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse faultActor: faultNode: faultDetail: {http://xml.apache.org/axis/}hostname:web57-node1.ebi.ac.uk Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse at org.apache.axis.providers.java.JavaProvider.getServiceClass(JavaProvider.java:432) at org.apache.axis.providers.java.JavaProvider.initServiceDesc(JavaProvider.java:461) at org.apache.axis.handlers.soap.SOAPService.getInitializedServiceDesc(SOAPService.java:286) at org.apache.axis.deployment.wsdd.WSDDService.makeNewInstance(WSDDService.java:500) at org.apache.axis.deployment.wsdd.WSDDDeployment.getDeployedServices(WSDDDeployment.java:503) at org.apache.axis.configuration.FileProvider.getDeployedServices(FileProvider.java:296) at org.apache.axis.transport.http.QSWSDLHandler.getDeployedServiceNames(QSWSDLHandler.java:218) at org.apache.axis.transport.http.QSWSDLHandler.updateSoapAddressLocationURLs(QSWSDLHandler.java:153) at org.apache.axis.transport.http.QSWSDLHandler.invoke(QSWSDLHandler.java:72) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.axis.transport.http.AxisServlet.processQuery(AxisServlet.java:1226) at org.apache.axis.transport.http.AxisServlet.doGet(AxisServlet.java:249) at javax.servlet.http.HttpServlet.service(HttpServlet.java:689) at org.apache.axis.transport.http.AxisServletBase.service(AxisServletBase.java:327) at javax.servlet.http.HttpServlet.service(HttpServlet.java:802) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:252) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:173) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:213) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:178) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:126) at org.apache.catalina.valves.ErrorReportValve.invoke(ErrorReportValve.java:105) at org.apache.catalina.core.StandardEngineValve.invoke(StandardEngineValve.java:107) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:148) at org.apache.jk.server.JkCoyoteHandler.invoke(JkCoyoteHandler.java:199) at org.apache.jk.common.HandlerRequest.invoke(HandlerRequest.java:282) at org.apache.jk.common.ChannelSocket.invoke(ChannelSocket.java:767) at org.apache.jk.common.ChannelSocket.processConnection(ChannelSocket.java:697) at org.apache.jk.common.ChannelSocket$SocketConnection.runIt(ChannelSocket.java:889) at org.apache.tomcat.util.threads.ThreadPool$ControlRunnable.run(ThreadPool.java:684) at java.lang.Thread.run(Thread.java:619) Caused by: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse at org.apache.catalina.loader.WebappClassLoader.loadClass(WebappClassLoader.java:1355) at org.apache.catalina.loader.WebappClassLoader.loadClass(WebappClassLoader.java:1201) at org.apache.axis.utils.ClassUtils$2.run(ClassUtils.java:187) at java.security.AccessController.doPrivileged(Native Method) at org.apache.axis.utils.ClassUtils.loadClass(ClassUtils.java:160) at org.apache.axis.utils.ClassUtils.forName(ClassUtils.java:142) at org.apache.axis.utils.cache.ClassCache.lookup(ClassCache.java:85) at org.apache.axis.providers.java.JavaProvider.getServiceClass(JavaProvider.java:428) ... 32 more at org.apache.axis.deployment.wsdd.WSDDService.makeNewInstance(WSDDService.java:502) at org.apache.axis.deployment.wsdd.WSDDDeployment.getDeployedServices(WSDDDeployment.java:503) at org.apache.axis.configuration.FileProvider.getDeployedServices(FileProvider.java:296) at org.apache.axis.transport.http.QSWSDLHandler.getDeployedServiceNames(QSWSDLHandler.java:218) at org.apache.axis.transport.http.QSWSDLHandler.updateSoapAddressLocationURLs(QSWSDLHandler.java:153) at org.apache.axis.transport.http.QSWSDLHandler.invoke(QSWSDLHandler.java:72) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.axis.transport.http.AxisServlet.processQuery(AxisServlet.java:1226) at org.apache.axis.transport.http.AxisServlet.doGet(AxisServlet.java:249) at javax.servlet.http.HttpServlet.service(HttpServlet.java:689) at org.apache.axis.transport.http.AxisServletBase.service(AxisServletBase.java:327) at javax.servlet.http.HttpServlet.service(HttpServlet.java:802) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:252) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:173) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:213) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:178) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:126) at org.apache.catalina.valves.ErrorReportValve.invoke(ErrorReportValve.java:105) at org.apache.catalina.core.StandardEngineValve.invoke(StandardEngineValve.java:107) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:148) at org.apache.jk.server.JkCoyoteHandler.invoke(JkCoyoteHandler.java:199) at org.apache.jk.common.HandlerRequest.invoke(HandlerRequest.java:282) at org.apache.jk.common.ChannelSocket.invoke(ChannelSocket.java:767) at org.apache.jk.common.ChannelSocket.processConnection(ChannelSocket.java:697) at org.apache.jk.common.ChannelSocket$SocketConnection.runIt(ChannelSocket.java:889) at org.apache.tomcat.util.threads.ThreadPool$ControlRunnable.run(ThreadPool.java:684) at java.lang.Thread.run(Thread.java:619) AxisFault faultCode: {http://schemas.xmlsoap.org/soap/envelope/}Server.generalException faultSubcode: faultString: Failed to determine deployed service names.; nested exception is: org.apache.axis.ConfigurationException: Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse AxisFault faultCode: {http://schemas.xmlsoap.org/soap/envelope/}Server.generalException faultSubcode: faultString: Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse faultActor: faultNode: faultDetail: {http://xml.apache.org/axis/}hostname:web57-node1.ebi.ac.uk Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse at org.apache.axis.providers.java.JavaProvider.getServiceClass(JavaProvider.java:432) at org.apache.axis.providers.java.JavaProvider.initServiceDesc(JavaProvider.java:461) at org.apache.axis.handlers.soap.SOAPService.getInitializedServiceDesc(SOAPService.java:286) at org.apache.axis.deployment.wsdd.WSDDService.makeNewInstance(WSDDService.java:500) at org.apache.axis.deployment.wsdd.WSDDDeployment.getDeployedServices(WSDDDeployment.java:503) at org.apache.axis.configuration.FileProvider.getDeployedServices(FileProvider.java:296) at org.apache.axis.transport.http.QSWSDLHandler.getDeployedServiceNames(QSWSDLHandler.java:218) at org.apache.axis.transport.http.QSWSDLHandler.updateSoapAddressLocationURLs(QSWSDLHandler.java:153) at org.apache.axis.transport.http.QSWSDLHandler.invoke(QSWSDLHandler.java:72) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.axis.transport.http.AxisServlet.processQuery(AxisServlet.java:1226) at org.apache.axis.transport.http.AxisServlet.doGet(AxisServlet.java:249) at javax.servlet.http.HttpServlet.service(HttpServlet.java:689) at org.apache.axis.transport.http.AxisServletBase.service(AxisServletBase.java:327) at javax.servlet.http.HttpServlet.service(HttpServlet.java:802) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:252) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:173) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:213) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:178) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:126) at org.apache.catalina.valves.ErrorReportValve.invoke(ErrorReportValve.java:105) at org.apache.catalina.core.StandardEngineValve.invoke(StandardEngineValve.java:107) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:148) at org.apache.jk.server.JkCoyoteHandler.invoke(JkCoyoteHandler.java:199) at org.apache.jk.common.HandlerRequest.invoke(HandlerRequest.java:282) at org.apache.jk.common.ChannelSocket.invoke(ChannelSocket.java:767) at org.apache.jk.common.ChannelSocket.processConnection(ChannelSocket.java:697) at org.apache.jk.common.ChannelSocket$SocketConnection.runIt(ChannelSocket.java:889) at org.apache.tomcat.util.threads.ThreadPool$ControlRunnable.run(ThreadPool.java:684) at java.lang.Thread.run(Thread.java:619) Caused by: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse at org.apache.catalina.loader.WebappClassLoader.loadClass(WebappClassLoader.java:1355) at org.apache.catalina.loader.WebappClassLoader.loadClass(WebappClassLoader.java:1201) at org.apache.axis.utils.ClassUtils$2.run(ClassUtils.java:187) at java.security.AccessController.doPrivileged(Native Method) at org.apache.axis.utils.ClassUtils.loadClass(ClassUtils.java:160) at org.apache.axis.utils.ClassUtils.forName(ClassUtils.java:142) at org.apache.axis.utils.cache.ClassCache.lookup(ClassCache.java:85) at org.apache.axis.providers.java.JavaProvider.getServiceClass(JavaProvider.java:428) ... 32 more org.apache.axis.ConfigurationException: Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse AxisFault faultCode: {http://schemas.xmlsoap.org/soap/envelope/}Server.generalException faultSubcode: faultString: Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse faultActor: faultNode: faultDetail: {http://xml.apache.org/axis/}hostname:web57-node1.ebi.ac.uk Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse at org.apache.axis.providers.java.JavaProvider.getServiceClass(JavaProvider.java:432) at org.apache.axis.providers.java.JavaProvider.initServiceDesc(JavaProvider.java:461) at org.apache.axis.handlers.soap.SOAPService.getInitializedServiceDesc(SOAPService.java:286) at org.apache.axis.deployment.wsdd.WSDDService.makeNewInstance(WSDDService.java:500) at org.apache.axis.deployment.wsdd.WSDDDeployment.getDeployedServices(WSDDDeployment.java:503) at org.apache.axis.configuration.FileProvider.getDeployedServices(FileProvider.java:296) at org.apache.axis.transport.http.QSWSDLHandler.getDeployedServiceNames(QSWSDLHandler.java:218) at org.apache.axis.transport.http.QSWSDLHandler.updateSoapAddressLocationURLs(QSWSDLHandler.java:153) at org.apache.axis.transport.http.QSWSDLHandler.invoke(QSWSDLHandler.java:72) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.axis.transport.http.AxisServlet.processQuery(AxisServlet.java:1226) at org.apache.axis.transport.http.AxisServlet.doGet(AxisServlet.java:249) at javax.servlet.http.HttpServlet.service(HttpServlet.java:689) at org.apache.axis.transport.http.AxisServletBase.service(AxisServletBase.java:327) at javax.servlet.http.HttpServlet.service(HttpServlet.java:802) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:252) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:173) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:213) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:178) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:126) at org.apache.catalina.valves.ErrorReportValve.invoke(ErrorReportValve.java:105) at org.apache.catalina.core.StandardEngineValve.invoke(StandardEngineValve.java:107) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:148) at org.apache.jk.server.JkCoyoteHandler.invoke(JkCoyoteHandler.java:199) at org.apache.jk.common.HandlerRequest.invoke(HandlerRequest.java:282) at org.apache.jk.common.ChannelSocket.invoke(ChannelSocket.java:767) at org.apache.jk.common.ChannelSocket.processConnection(ChannelSocket.java:697) at org.apache.jk.common.ChannelSocket$SocketConnection.runIt(ChannelSocket.java:889) at org.apache.tomcat.util.threads.ThreadPool$ControlRunnable.run(ThreadPool.java:684) at java.lang.Thread.run(Thread.java:619) Caused by: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse at org.apache.catalina.loader.WebappClassLoader.loadClass(WebappClassLoader.java:1355) at org.apache.catalina.loader.WebappClassLoader.loadClass(WebappClassLoader.java:1201) at org.apache.axis.utils.ClassUtils$2.run(ClassUtils.java:187) at java.security.AccessController.doPrivileged(Native Method) at org.apache.axis.utils.ClassUtils.loadClass(ClassUtils.java:160) at org.apache.axis.utils.ClassUtils.forName(ClassUtils.java:142) at org.apache.axis.utils.cache.ClassCache.lookup(ClassCache.java:85) at org.apache.axis.providers.java.JavaProvider.getServiceClass(JavaProvider.java:428) ... 32 more at org.apache.axis.deployment.wsdd.WSDDService.makeNewInstance(WSDDService.java:502) at org.apache.axis.deployment.wsdd.WSDDDeployment.getDeployedServices(WSDDDeployment.java:503) at org.apache.axis.configuration.FileProvider.getDeployedServices(FileProvider.java:296) at org.apache.axis.transport.http.QSWSDLHandler.getDeployedServiceNames(QSWSDLHandler.java:218) at org.apache.axis.transport.http.QSWSDLHandler.updateSoapAddressLocationURLs(QSWSDLHandler.java:153) at org.apache.axis.transport.http.QSWSDLHandler.invoke(QSWSDLHandler.java:72) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.axis.transport.http.AxisServlet.processQuery(AxisServlet.java:1226) at org.apache.axis.transport.http.AxisServlet.doGet(AxisServlet.java:249) at javax.servlet.http.HttpServlet.service(HttpServlet.java:689) at org.apache.axis.transport.http.AxisServletBase.service(AxisServletBase.java:327) at javax.servlet.http.HttpServlet.service(HttpServlet.java:802) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:252) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:173) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:213) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:178) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:126) at org.apache.catalina.valves.ErrorReportValve.invoke(ErrorReportValve.java:105) at org.apache.catalina.core.StandardEngineValve.invoke(StandardEngineValve.java:107) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:148) at org.apache.jk.server.JkCoyoteHandler.invoke(JkCoyoteHandler.java:199) at org.apache.jk.common.HandlerRequest.invoke(HandlerRequest.java:282) at org.apache.jk.common.ChannelSocket.invoke(ChannelSocket.java:767) at org.apache.jk.common.ChannelSocket.processConnection(ChannelSocket.java:697) at org.apache.jk.common.ChannelSocket$SocketConnection.runIt(ChannelSocket.java:889) at org.apache.tomcat.util.threads.ThreadPool$ControlRunnable.run(ThreadPool.java:684) at java.lang.Thread.run(Thread.java:619) faultActor: faultNode: faultDetail: {http://xml.apache.org/axis/}hostname:web57-node1.ebi.ac.uk From uludag at ebi.ac.uk Thu Mar 6 17:45:13 2008 From: uludag at ebi.ac.uk (uludag at ebi.ac.uk) Date: Thu, 6 Mar 2008 22:45:13 -0000 (GMT) Subject: [EMBOSS] broken links for EMBOSS web services In-Reply-To: <47D06CB0.4050608@cs.utah.edu> References: <47D06CB0.4050608@cs.utah.edu> Message-ID: <49965.81.156.216.123.1204843513.squirrel@webmail.ebi.ac.uk> Hi Lorena, > There are problem with some links: > http://www.ebi.ac.uk/soaplab/emboss4/servlet/AxisServlet The links are now back to Normal. Regards, Mahmut From staffa at niehs.nih.gov Mon Mar 10 11:50:40 2008 From: staffa at niehs.nih.gov (Staffa, Nick (NIH/NIEHS)) Date: Mon, 10 Mar 2008 11:50:40 -0400 Subject: [EMBOSS] Databases Message-ID: We are making a gradual transition from GCG to EMBOSS. Please point me to some explicit instructions for making GCG databases accesable to EMBOSS/Jemboss Thank you Nick Staffa Telephone: 919-316-4569 (NIEHS: 6-4569) Scientific Computing Support Group NIEHS Information Technology Support Services Contract (Science Task Monitor: Roy W. Reter (reter at niehs.nih.gov) National Institute of Environmental Health Sciences National Institutes of Health Research Triangle Park, North Carolina From pmr at ebi.ac.uk Mon Mar 10 12:22:02 2008 From: pmr at ebi.ac.uk (Peter Rice) Date: Mon, 10 Mar 2008 16:22:02 +0000 Subject: [EMBOSS] Databases In-Reply-To: References: Message-ID: <47D5602A.90309@ebi.ac.uk> Dear Nick, Staffa, Nick (NIH/NIEHS) wrote: > We are making a gradual transition from GCG to EMBOSS. > Please point me to some explicit instructions for making GCG databases > accesable to EMBOSS/Jemboss EMBOSS has two database indexing applications for GCG databases: dbxgcg and the older dbigcg. There is a fix for release 5.0.0 for changes to the sayntax of GCG database ID lines. This assumes you are still planning to maintain GCG databases - though I understand UniProt broke GCG recently by having records longer than 255 characters. EMBOSS can also index the native flatfiles with dbxflat, and FASTA files with dbxfasta. With databases indexed in dbxgcg the database definitions look like: DB gcgnuc [ type: N method: embossgcg format: embl directory: "/homes/pmr/data/gcg/gcg_data" indexdir: "/homes/pmr/gcg/index" ] format refers to the text part of the entry (the REF file) With databases indexed in the older dbigcg the database definitions look similar. Change "embossgcg" to "gcg" for the method. Let us know if you ave any more questions. Peter From shrish at ccmb.res.in Fri Mar 14 04:45:26 2008 From: shrish at ccmb.res.in (Shrish Tiwari) Date: Fri, 14 Mar 2008 14:15:26 +0530 (IST) Subject: [EMBOSS] help Message-ID: <32925720.1205484326500.JavaMail.root@127.0.0.1> An embedded and charset-unspecified text was scrubbed... Name: not available URL: From uludag at ebi.ac.uk Fri Mar 14 06:18:57 2008 From: uludag at ebi.ac.uk (Mahmut Uludag) Date: Fri, 14 Mar 2008 10:18:57 +0000 Subject: [EMBOSS] help In-Reply-To: <32925720.1205484326500.JavaMail.root@127.0.0.1> References: <32925720.1205484326500.JavaMail.root@127.0.0.1> Message-ID: <1205489937.3630.22.camel@emboss2.ebi.ac.uk> Hi, > I installed EMBOSS 10.0 on an OPENSUSE Linux machine. I did a make > install in the end to move stuff to the usr/local/bin folder so that > the programs are accessible to everyone. Now when I give the path from > where EMBOSS was installed, the programs run, e.g. > /usr/local/EMBOSS/EMBOSS-2.10.0/emboss/wossname runs fine > But when I type just wossname I get the following error: > shrish at genesys:~> wossname > wossname: error while loading shared libraries: libnucleus.so.0: > cannot open shared object file: No such file or directory > Where did I go wrong? I have installed EMBOSS earlier on other > versions of Unix and Linux, without any hassles. I think it would help you understand the problem if you first know which wossname is executed (call 'which wossname' to learn it), then using the 'ldd' command you can check which shared libraries that wossname executable is using. If you don't have specific reasons it is always better to install the latest stable release of EMBOSS, which is EMBOSS-5.0.0 Regards, Mahmut From ajb at ebi.ac.uk Fri Mar 14 06:37:42 2008 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Fri, 14 Mar 2008 10:37:42 -0000 (GMT) Subject: [EMBOSS] help In-Reply-To: <32925720.1205484326500.JavaMail.root@127.0.0.1> References: <32925720.1205484326500.JavaMail.root@127.0.0.1> Message-ID: <51369.86.14.232.77.1205491062.squirrel@webmail.ebi.ac.uk> This has been reported before but we've never been able to reproduce it. It seems to be limited to just some SuSE systems. As you've installed to /usr/local then the binaries will be in /usr/local/bin and the libraries in /usr/local/lib. So, there are two ways you can get things to work. a) Add /usr/local/lib to your LD_LIBRARY_PATH environment variable e.g. export LD_LIBRARY_PATH=/usr/local/lib:$LD_LIBRARY_PATH b) Add the line: /usr/local/lib to your system /etc/ld.so.conf file and then type "ldconfig" [In order for this change to work you may need to restart the computer] I should also point out that version 2.10.0 of EMBOSS is rather out of date. The current version is 5.0.0 - it will have a newer version of 'libtool' incorporated which may or may not solve this feature of SuSE. Alan > Hi! > I installed EMBOSS 10.0 on an OPENSUSE Linux machine. I did a make install > in the end to move stuff to the usr/local/bin folder so that the programs > are accessible to everyone. Now when I give the path from where EMBOSS was > installed, the programs run, e.g. > /usr/local/EMBOSS/EMBOSS-2.10.0/emboss/wossname runs fine > But when I type just wossname I get the following error: > shrish at genesys:~> wossname > wossname: error while loading shared libraries: libnucleus.so.0: cannot > open shared object file: No such file or directory > Where did I go wrong? I have installed EMBOSS earlier on other versions of > Unix and Linux, without any hassles. > Shrish > Dr. Shrish Tiwari > E503, Centre for Cellular and Molecular Biology > Uppal Road, Hyderabad - 500 007, INDIA > Phone: 91-40-27192777 > Alternate email: shrish.geo at yahoo.com > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From Sebastien.Moretti at unil.ch Fri Mar 14 10:23:57 2008 From: Sebastien.Moretti at unil.ch (Sebastien Moretti) Date: Fri, 14 Mar 2008 15:23:57 +0100 Subject: [EMBOSS] ACD syntax error for infile Message-ID: <47DA8A7D.2010005@unil.ch> Hello, I try to build my own ACD file for one of our application but acdvalid returns a strange error message: Warning: File tmpred.acd line 26: Information string for 'in' not standard 'Sequence file' Error: File tmpred.acd line 26: First input file 'in' is not a parameter Warning: File tmpred.acd line 26: Infile qualifier 'in' is not 'infile' or '*file'(should be 'infile') Here is the problematic section: section: input [ information: "Input section" type: "page" ] infile: in [ standard: "Y" knowntype: "sequence data" prompt: "Name of Sequence (in arbitrary format)" information: "Protein Sequence or Accession number input" ] ... Do you know how to resolve this ? (I use EMBOSS 5.0.0) Thanks -- S?bastien Moretti SIB, Quartier Sorge - Genopode CH-1015 Lausanne, Switzerland Tel.: +41 (21) 692 4056/4221 From ajb at ebi.ac.uk Fri Mar 14 11:38:41 2008 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Fri, 14 Mar 2008 15:38:41 -0000 (GMT) Subject: [EMBOSS] ACD syntax error for infile In-Reply-To: <47DA8A7D.2010005@unil.ch> References: <47DA8A7D.2010005@unil.ch> Message-ID: <59819.86.14.232.77.1205509121.squirrel@webmail.ebi.ac.uk> The error message is, in this case, rather helpful. Just change 'standard' to 'parameter'. The rationale for this is that the first input file in an ACD file should usually be a 'parameter' to enable people to just specify the filename (without qualifier switch) on the command line. acdvalid will just give warnings for subsequent files that aren't marked as parameters. The warnings are just that the first infile is usually has the name 'infile' for consistency with other EMBOSS applications. You can choose to ignore warnings for local applications. So, infile: infile [ parameter: "Y" knowntype: "sequence data" prompt: "Name of Sequence (in arbitrary format)" information: "Protein Sequence or Accession number input" ] is what acdvalid would prefer. HTH Alan > Hello, > > I try to build my own ACD file for one of our application but acdvalid > returns a strange error message: > > Warning: File tmpred.acd line 26: Information string for 'in' not > standard 'Sequence file' > Error: File tmpred.acd line 26: First input file 'in' is not a parameter > Warning: File tmpred.acd line 26: Infile qualifier 'in' is not 'infile' > or '*file'(should be 'infile') > > > Here is the problematic section: > section: input [ > information: "Input section" > type: "page" > ] > > infile: in [ > standard: "Y" > knowntype: "sequence data" > prompt: "Name of Sequence (in arbitrary format)" > information: "Protein Sequence or Accession number input" > ] > ... > > Do you know how to resolve this ? > (I use EMBOSS 5.0.0) > > Thanks > > > -- > S??bastien Moretti > SIB, Quartier Sorge - Genopode > CH-1015 Lausanne, Switzerland > Tel.: +41 (21) 692 4056/4221 > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From Sebastien.Moretti at unil.ch Fri Mar 14 11:56:03 2008 From: Sebastien.Moretti at unil.ch (Sebastien Moretti) Date: Fri, 14 Mar 2008 16:56:03 +0100 Subject: [EMBOSS] ACD syntax error for infile In-Reply-To: <59819.86.14.232.77.1205509121.squirrel@webmail.ebi.ac.uk> References: <47DA8A7D.2010005@unil.ch> <59819.86.14.232.77.1205509121.squirrel@webmail.ebi.ac.uk> Message-ID: <47DAA013.7010000@unil.ch> > The error message is, in this case, rather helpful. Just change > 'standard' to 'parameter'. The rationale for this is that the first > input file in an ACD file should usually be a 'parameter' to enable > people to just specify the filename (without qualifier switch) on the > command line. acdvalid will just give warnings for subsequent files that > aren't marked as parameters. > > The warnings are just that the first infile is usually has the > name 'infile' for consistency with other EMBOSS applications. > You can choose to ignore warnings for local applications. > > So, > > infile: infile [ > parameter: "Y" > knowntype: "sequence data" > prompt: "Name of Sequence (in arbitrary format)" > information: "Protein Sequence or Accession number input" > ] > > is what acdvalid would prefer. > > HTH > > Alan Hi Alan, Thanks, nevertheless, I cannot use 'parameter: "Y"' because my application requires both parameter-name and parameter-value: -in=your_file So, I will try to use the ACD file with the error. >> Hello, >> >> I try to build my own ACD file for one of our application but acdvalid >> returns a strange error message: >> >> Warning: File tmpred.acd line 26: Information string for 'in' not >> standard 'Sequence file' >> Error: File tmpred.acd line 26: First input file 'in' is not a parameter >> Warning: File tmpred.acd line 26: Infile qualifier 'in' is not 'infile' >> or '*file'(should be 'infile') >> >> >> Here is the problematic section: >> section: input [ >> information: "Input section" >> type: "page" >> ] >> >> infile: in [ >> standard: "Y" >> knowntype: "sequence data" >> prompt: "Name of Sequence (in arbitrary format)" >> information: "Protein Sequence or Accession number input" >> ] >> ... >> >> Do you know how to resolve this ? >> (I use EMBOSS 5.0.0) >> >> Thanks -- S?bastien Moretti SIB, Quartier Sorge - Genopode CH-1015 Lausanne, Switzerland Tel.: +41 (21) 692 4056/4221 From Sebastien.Moretti at unil.ch Fri Mar 14 11:56:40 2008 From: Sebastien.Moretti at unil.ch (Sebastien Moretti) Date: Fri, 14 Mar 2008 16:56:40 +0100 Subject: [EMBOSS] See ACD as command line Message-ID: <47DAA038.4060804@unil.ch> Hello, Is there a simple way to see our ACD files as command lines ? I would like to check the command line syntax without running the application. Thanks -- S?bastien Moretti From pmr at ebi.ac.uk Fri Mar 14 12:36:27 2008 From: pmr at ebi.ac.uk (Peter Rice) Date: Fri, 14 Mar 2008 16:36:27 +0000 Subject: [EMBOSS] ACD syntax error for infile In-Reply-To: <47DAA013.7010000@unil.ch> References: <47DA8A7D.2010005@unil.ch> <59819.86.14.232.77.1205509121.squirrel@webmail.ebi.ac.uk> <47DAA013.7010000@unil.ch> Message-ID: <47DAA98B.503@ebi.ac.uk> Sebastien Moretti wrote: > Thanks, > nevertheless, I cannot use 'parameter: "Y"' because my application > requires both parameter-name and parameter-value: > -in=your_file > > So, I will try to use the ACD file with the error. No problem. acdvalid is there to check consistency for the main EMBOSS and EMBASSY ACD files. The applications will run with no problem. Note: if you have the parameter definition, and the infile qualifier name, the -in=your_file syntax will still be valid on the command line :-) Peter From pmr at ebi.ac.uk Fri Mar 14 12:40:48 2008 From: pmr at ebi.ac.uk (Peter Rice) Date: Fri, 14 Mar 2008 16:40:48 +0000 Subject: [EMBOSS] See ACD as command line In-Reply-To: <47DAA038.4060804@unil.ch> References: <47DAA038.4060804@unil.ch> Message-ID: <47DAAA90.2060603@ebi.ac.uk> Hi Sabastian, Sebastien Moretti wrote: > Hello, > > Is there a simple way to see our ACD files as command lines ? > > I would like to check the command line syntax without running the > application. No problem. You do not even need to write the application. With the acd file written you just need: acdc appname to try running the application. It will read input and open output files and then stop. acdc appname -help will give you the help If you have the application written then appname -help will work too. If you need more we can help .... all we need to do it write something like "acdtable" and add a different control call to dump out a command line from the ACD processing. For example, we could show the shortest abbreviations of qualifier names. regards, Peter From staffa at niehs.nih.gov Mon Mar 17 18:44:33 2008 From: staffa at niehs.nih.gov (Staffa, Nick (NIH/NIEHS)) Date: Mon, 17 Mar 2008 18:44:33 -0400 Subject: [EMBOSS] Jemboss Alignment Editor Message-ID: what's up? Does anybody use Jemboss? Is it supposed to work as advertised? If I click on a file, even an GCG msf file, and do a right-click, open With/Jemboss Alignment Editor, the editor does not pop up. When I bring the JAL up from the Tools menu, and do a File/Open.... to get an msf file from the server or from the desktop, I don't see that anything has entered the JAL. What could be up, Doc? Jalview can open msf files that are local, but is not an option on "Open With...". From Marc.Logghe at ablynx.com Wed Mar 19 04:29:28 2008 From: Marc.Logghe at ablynx.com (Marc Logghe) Date: Wed, 19 Mar 2008 09:29:28 +0100 Subject: [EMBOSS] needle -nobrief Message-ID: <03C512635899144083CADB0EE222018901792167@alpaca.lan.ablynx.com> Hi all, I have checked the docs and googled around but I did not find an explanation for how the shortest_similarity or shortest_identity is calculated by needle (using the -nobrief option). For longest_identity it seems to be: (Identical residues x 100)/(Length of Alignment - Total Number of Gaps in Alignment) Thanks and regards, Marc From ajb at ebi.ac.uk Wed Mar 19 05:29:26 2008 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Wed, 19 Mar 2008 09:29:26 -0000 (GMT) Subject: [EMBOSS] needle -nobrief In-Reply-To: <03C512635899144083CADB0EE222018901792167@alpaca.lan.ablynx.com> References: <03C512635899144083CADB0EE222018901792167@alpaca.lan.ablynx.com> Message-ID: <47038.86.14.232.77.1205918966.squirrel@webmail.ebi.ac.uk> >From a quick look at the code: Longest identity: you're right i.e. (Identical residues x 100)/(Length of Alignment - Total Number of Gaps in Alignment) Shortest identity = number of identical residues * 100 / length of longest original sequence The similarity calculations are the same as the 'identical' ones except that the number of identical residues is replaced by the number of pairwise comparisons that have a positive score in the comparison matrix. HTH Alan > Hi all, > > I have checked the docs and googled around but I did not find an > explanation for how the shortest_similarity or shortest_identity is > calculated by needle (using the -nobrief option). > > For longest_identity it seems to be: > > (Identical residues x 100)/(Length of Alignment - Total Number of Gaps > in Alignment) > > Thanks and regards, > > Marc > > > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From Marc.Logghe at ablynx.com Wed Mar 19 06:08:07 2008 From: Marc.Logghe at ablynx.com (Marc Logghe) Date: Wed, 19 Mar 2008 11:08:07 +0100 Subject: [EMBOSS] needle -nobrief In-Reply-To: <47038.86.14.232.77.1205918966.squirrel@webmail.ebi.ac.uk> References: <03C512635899144083CADB0EE222018901792167@alpaca.lan.ablynx.com> <47038.86.14.232.77.1205918966.squirrel@webmail.ebi.ac.uk> Message-ID: <03C512635899144083CADB0EE22201890179221D@alpaca.lan.ablynx.com> Great, thanks ! > -----Original Message----- > From: ajb at ebi.ac.uk [mailto:ajb at ebi.ac.uk] > Sent: Wednesday, March 19, 2008 10:29 AM > To: Marc Logghe > Cc: emboss at lists.open-bio.org > Subject: Re: [EMBOSS] needle -nobrief > > > From a quick look at the code: > > > Longest identity: you're right i.e. > (Identical residues x 100)/(Length of Alignment - Total Number of Gaps > in Alignment) > > > > Shortest identity = number of identical residues * 100 / > length of longest original sequence > > > The similarity calculations are the same as the 'identical' ones > except that the number of identical residues is replaced by the > number of pairwise comparisons that have a positive score in > the comparison matrix. > > HTH > > Alan > > > > > > Hi all, > > > > I have checked the docs and googled around but I did not find an > > explanation for how the shortest_similarity or shortest_identity is > > calculated by needle (using the -nobrief option). > > > > For longest_identity it seems to be: > > > > (Identical residues x 100)/(Length of Alignment - Total Number of Gaps > > in Alignment) > > > > Thanks and regards, > > > > Marc > > > > > > > > > > _______________________________________________ > > EMBOSS mailing list > > EMBOSS at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/emboss > > > From gbottu at vub.ac.be Wed Mar 19 06:22:14 2008 From: gbottu at vub.ac.be (Guy Bottu) Date: Wed, 19 Mar 2008 11:22:14 +0100 Subject: [EMBOSS] needle -nobrief In-Reply-To: <03C512635899144083CADB0EE222018901792167@alpaca.lan.ablynx.com> References: <03C512635899144083CADB0EE222018901792167@alpaca.lan.ablynx.com> Message-ID: <47E0E956.7070308@vub.ac.be> Dear Marc, I indeed do not see the explanation in the manual, but I did some testing and I understand that : - Identity and Similarity are computed by dividing by the total length of the alignment - Longest_Identity and Longest_Similarity are computed by dividing by the number of aligned positions (= total length of the alignment - number of indels) - Shortest_Identity and Shortest_Similarity are computed by dividing by the length of the longest sequence Regards, Guy Bottu, Belgian EMBnet Node From staffa at niehs.nih.gov Wed Mar 19 13:20:19 2008 From: staffa at niehs.nih.gov (Staffa, Nick (NIH/NIEHS)) Date: Wed, 19 Mar 2008 13:20:19 -0400 Subject: [EMBOSS] [Jemboss] needle Jemboss on MacIntosh In-Reply-To: <47E0E956.7070308@vub.ac.be> Message-ID: Running Jemboss on a Mac. I have a folder of GCG sequences, one of which I have included. When I open these files in textedit, they are complete. However when double clicked in the file manager, they look like fasta files with no sequence information. Likewise when input to a program like needle. It doesn't seem to matter what is done with Input Sequence Options. What's Up, Doc? Nick Staffa Telephone: 919-316-4569 (NIEHS: 6-4569) Scientific Computing Support Group NIEHS Information Technology Support Services Contract (Science Task Monitor: Roy W. Reter (reter at niehs.nih.gov) National Institute of Environmental Health Sciences National Institutes of Health Research Triangle Park, North Carolina -------------- next part -------------- An embedded and charset-unspecified text was scrubbed... Name: hspgk2g.seq URL: From ajb at ebi.ac.uk Wed Mar 19 16:16:43 2008 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Wed, 19 Mar 2008 20:16:43 -0000 (GMT) Subject: [EMBOSS] [Jemboss] needle Jemboss on MacIntosh In-Reply-To: References: <47E0E956.7070308@vub.ac.be> Message-ID: <56434.86.14.232.77.1205957803.squirrel@webmail.ebi.ac.uk> Is this a case of running a Jemboss client on the Mac but the Jemboss server on a UNIX machine? If that is the case then the problem is likely to be that your input files have lines terminated with '\r' whereas the server will be expecting them to terminate with '\n'. EMBOSS does cater for '\r'-terminated files but only if EMBOSS itself is compiled under MacOSX PPC. The first thing to try would be for you to convert the files i.e. under UNIX you could use: tr '\r' '\n' < macfile > unixfile to do it. Then try giving the UNIX-formatted file to the server. We could arrange for EMBOSS to always detect whether UNIX (LF), Mac (CR) or M$ (CRLF) user files are given but it'd be a performance hit. One way would be to provide it as an EMBOSS configuration option. We'll discuss it anyway. HTH Alan > > Running Jemboss on a Mac. > I have a folder of GCG sequences, one of which I have included. > When I open these files in textedit, they are complete. > However when double clicked in the file manager, they look like fasta > files > with no sequence information. Likewise when input to a program like > needle. > It doesn't seem to matter what is done with Input Sequence Options. > > What's Up, Doc? > > > > Nick Staffa > Telephone: 919-316-4569 (NIEHS: 6-4569) > Scientific Computing Support Group > NIEHS Information Technology Support Services Contract > (Science Task Monitor: Roy W. Reter (reter at niehs.nih.gov) > National Institute of Environmental Health Sciences > National Institutes of Health > Research Triangle Park, North Carolina > > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From robin at hms.harvard.edu Thu Mar 20 14:57:43 2008 From: robin at hms.harvard.edu (Robin Colgrove) Date: Thu, 20 Mar 2008 14:57:43 -0400 Subject: [EMBOSS] Run Date error in fuzzpro and patmatdb? Message-ID: <48CA384F-277E-4E2D-B92A-0980B70FFF45@hms.harvard.edu> Hi all. I haven't posted here for a long time so apologies if I do this the wrong way. I am only an occasional EMBOSS user (v 2.10.0, OSX, command line) but I was just running fuzzpro and patmatdb and got a weird date: # Program: fuzzpro # Rundate: Sun Mar 20 2008 14:46:12 # Report_format: seqtable # Report_file: hsv-1icp8.fuzzpro Now, I am pretty sure it is not Sunday. Same error occurs in patmatdb. Is this a known bug? program seem to work fine otherwise. thanks robin colgrove micro dept. harvard med From ajb at ebi.ac.uk Thu Mar 20 19:06:10 2008 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Thu, 20 Mar 2008 23:06:10 -0000 (GMT) Subject: [EMBOSS] Run Date error in fuzzpro and patmatdb? In-Reply-To: <48CA384F-277E-4E2D-B92A-0980B70FFF45@hms.harvard.edu> References: <48CA384F-277E-4E2D-B92A-0980B70FFF45@hms.harvard.edu> Message-ID: <59884.86.14.232.77.1206054370.squirrel@webmail.ebi.ac.uk> Hello Robin, I cannot reproduce it on my non-MacOSX UNIXen here with 2.10.0 (or indeed 5.0.0 which you might consider trying - I can't see anything in the source code logs that mention the effect you're seeing but it's worth a shot). I'd be glad of further details (i.e. MacOSX version, architecture [ppc or x86], compiler version, Xcode tools version). Bugs in the implementation of the system strftime() function on various operating systems are not uncommon. I also cannot recall anyone ever reporting such a bug. If anyone else has ever seen this or solved it then please send us details (emboss-bug at emboss.open-bio.org). Thanks Alan > > Hi all. > I haven't posted here for a long time so apologies if I do this the > wrong way. > I am only an occasional EMBOSS user (v 2.10.0, OSX, command line) but > I was just running fuzzpro and patmatdb and got a weird date: > > # Program: fuzzpro > # Rundate: Sun Mar 20 2008 14:46:12 > # Report_format: seqtable > # Report_file: hsv-1icp8.fuzzpro > > > Now, I am pretty sure it is not Sunday. > Same error occurs in patmatdb. > > Is this a known bug? > > program seem to work fine otherwise. > > thanks > > robin colgrove > micro dept. > harvard med > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From car44 at cam.ac.uk Tue Mar 25 16:36:11 2008 From: car44 at cam.ac.uk (C.A. Russell) Date: 25 Mar 2008 20:36:11 +0000 Subject: [EMBOSS] fdrawgram, no prompting Message-ID: I'm trying to automate the plotting of a large number of trees. I'm using the following command to plot trees fdrawgram -intreefile infile -plotfile outfile.ps -previewer n -plotter l -auto Everything is good except that I can't figure out how to stop fdrawgram from prompting me with "Is the tree ready to be plotted? Type Y or N:" I thought that -auto should make the assumption that indeed the tree is ready to be plotted but I still get prompted. Can anyone tell what arguments to pass to fdrawgram to make it not prompt me? If it makes a difference I'm running OS X 10.4.9 Many thanks Colin From uludag at ebi.ac.uk Wed Mar 26 07:40:18 2008 From: uludag at ebi.ac.uk (Mahmut Uludag) Date: Wed, 26 Mar 2008 11:40:18 +0000 Subject: [EMBOSS] fdrawgram, no prompting In-Reply-To: References: Message-ID: <1206531618.10249.20.camel@emboss2.ebi.ac.uk> > I'm trying to automate the plotting of a large number of trees. I'm using > the following command to plot trees > > fdrawgram -intreefile infile -plotfile outfile.ps -previewer n -plotter l > -auto > > Everything is good except that I can't figure out how to stop fdrawgram > from prompting me with > > "Is the tree ready to be plotted? Type Y or N:" > > I thought that -auto should make the assumption that indeed the tree is > ready to be plotted but I still get prompted. Can anyone tell what > arguments to pass to fdrawgram to make it not prompt me? If you don't present the previewer option on the command line then emboss doesn't ask the above question. (fdrawgram documentation suggests that when previewer is 'n' (means 'will not be previewed') the above question should not be asked. I'm sure you will get a full reply to your question from Peter.) Regards, Mahmut From schueffi at mpi-sb.mpg.de Fri Mar 28 06:26:17 2008 From: schueffi at mpi-sb.mpg.de (=?ISO-8859-1?Q?Peter_Sch=FCffler?=) Date: Fri, 28 Mar 2008 11:26:17 +0100 Subject: [EMBOSS] HELP!! ePrimer3 service down? Message-ID: <47ECC7C9.504@mpi-sb.mpg.de> Hallo, I'm using the eprimer3 service from EMBOSS in my Java source code. This is a great service!!! :-) But for a while, the service doesn't work (but has worked before!). Here my source code and the failure message from Java. Do I something wrong, or does server something wrong? THANK YOU!!! Peter public static void main(String[] args) { String seq = "TCTAGAAAAATTTTTTAAAAAATTAGGCCGCTCGAGCGAGAGTGCAGTGGCTCACGCCTGTAATCCAACA" + "CTTCAGGAGGCTGAAGAGGGTGGATCACCTGAGGTCAGGAGTTCCAGACCAGCCTGGCCAACATGGTGAA"; try { // CONSTRUCT THE SERVICE AnalysisServiceService service = new AnalysisServiceServiceLocator(); Nucleic_PrimersEprimer3SoapBindingStub primer = (Nucleic_PrimersEprimer3SoapBindingStub) service.getNucleic_PrimersEprimer3(); // SET UP THE PARAMETERS HashMap params = new HashMap(); params.put("sequence_direct_data", seq); params.put("task", 1); params.put("numreturn", 100); // RUN ePRIMER3 HashMap result = primer.runAndWaitFor(params); String output = (String) result.get("outfile"); System.out.println(output); } catch (RemoteException ex) { Logger.getLogger(Eprimer3.class.getName()).log(Level.SEVERE, null, ex); } catch (Exception ex) { Logger.getLogger(Eprimer3.class.getName()).log(Level.SEVERE, null, ex); } } HERE THE MESSAGE:: Mar 28, 2008 11:24:07 AM mm_filters.Eprimer3 main SEVERE: null AxisFault faultCode: {http://schemas.xmlsoap.org/soap/envelope/}Server.userException faultString: java.lang.IllegalArgumentException: Conversion to SoaplabMap failed: Found an unsupported type 'java.lang.Integer'. faultActor: null faultDetail: hostname: web57-node1.ebi.ac.uk java.lang.IllegalArgumentException: Conversion to SoaplabMap failed: Found an unsupported type 'java.lang.Integer'. at org.apache.axis.message.SOAPFaultBuilder.endElement(SOAPFaultBuilder.java:135) at org.apache.axis.encoding.DeserializationContextImpl.endElement(DeserializationContextImpl.java:942) at org.apache.xerces.parsers.AbstractSAXParser.endElement(Unknown Source) at org.apache.xerces.impl.XMLNSDocumentScannerImpl.scanEndElement(Unknown Source) at org.apache.xerces.impl.XMLDocumentFragmentScannerImpl$FragmentContentDispatcher.dispatch(Unknown Source) at org.apache.xerces.impl.XMLDocumentFragmentScannerImpl.scanDocument(Unknown Source) at org.apache.xerces.parsers.DTDConfiguration.parse(Unknown Source) at org.apache.xerces.parsers.DTDConfiguration.parse(Unknown Source) at org.apache.xerces.parsers.XMLParser.parse(Unknown Source) at org.apache.xerces.parsers.AbstractSAXParser.parse(Unknown Source) at javax.xml.parsers.SAXParser.parse(SAXParser.java:375) at org.apache.axis.encoding.DeserializationContextImpl.parse(DeserializationContextImpl.java:232) at org.apache.axis.SOAPPart.getAsSOAPEnvelope(SOAPPart.java:546) at org.apache.axis.Message.getSOAPEnvelope(Message.java:377) at org.apache.axis.client.Call.invokeEngine(Call.java:2132) at org.apache.axis.client.Call.invoke(Call.java:2102) at org.apache.axis.client.Call.invoke(Call.java:1851) at org.apache.axis.client.Call.invoke(Call.java:1777) at org.apache.axis.client.Call.invoke(Call.java:1315) at uk.ac.ebi.www.Nucleic_PrimersEprimer3SoapBindingStub.runAndWaitFor(Nucleic_PrimersEprimer3SoapBindingStub.java:435) at mm_filters.Eprimer3.main(Eprimer3.java:162) From uludag at ebi.ac.uk Fri Mar 28 07:17:08 2008 From: uludag at ebi.ac.uk (Mahmut Uludag) Date: Fri, 28 Mar 2008 11:17:08 +0000 Subject: [EMBOSS] HELP!! ePrimer3 service down? In-Reply-To: <47ECC7C9.504@mpi-sb.mpg.de> References: <47ECC7C9.504@mpi-sb.mpg.de> Message-ID: <1206703028.12782.18.camel@emboss2.ebi.ac.uk> > But for a while, the service doesn't work (but has worked before!). should be related to changes I made recently :( will check it and return back soon! Mahmut From pmr at ebi.ac.uk Fri Mar 28 07:53:33 2008 From: pmr at ebi.ac.uk (Peter Rice) Date: Fri, 28 Mar 2008 11:53:33 +0000 Subject: [EMBOSS] fdrawgram, no prompting In-Reply-To: <1206531618.10249.20.camel@emboss2.ebi.ac.uk> References: <1206531618.10249.20.camel@emboss2.ebi.ac.uk> Message-ID: <47ECDC3D.5010402@ebi.ac.uk> Mahmut Uludag wrote: > (fdrawgram documentation suggests that when previewer is 'n' (means > 'will not be previewed') the above question should not be asked. I'm > sure you will get a full reply to your question from Peter.) Just back from vacation without email - very relaxing. There is a bug caused by a clash between the EMBOSS interface turning off the preview and some phylip code turning it on again. It will be fixed in the next release. If you are desperate to turn off the message I can send a couple of simple updates to the source code to fix it. > If you don't present the previewer option on the command line then > emboss doesn't ask the above question. This is another bug which fails to preview in X11 ... phylip defines Xwindows in a different way to EMBOSS. With a quick fix I can make the X previewer work, but there are also problems with the fonts. It will be fixed for the next release, which will also include an upgrade to use the latest phylip version. Hope that helps, Peter From uludag at ebi.ac.uk Fri Mar 28 08:00:07 2008 From: uludag at ebi.ac.uk (Mahmut Uludag) Date: Fri, 28 Mar 2008 12:00:07 +0000 Subject: [EMBOSS] HELP!! ePrimer3 service down? In-Reply-To: <47ECC7C9.504@mpi-sb.mpg.de> References: <47ECC7C9.504@mpi-sb.mpg.de> Message-ID: <1206705608.12782.27.camel@emboss2.ebi.ac.uk> Hi Peter, > But for a while, the service doesn't work (but has worked before!). Can you please try running the service again? We recently moved the server to Soaplab-2 where we have some changes in the generic input maps. I have checked in a fix for this problem and updated the server and will later discuss this issue with Martin for a proper fix that might go into the soaplab-2 code base. Regards, Mahmut > Here my source code and the failure message from Java. > > Do I something wrong, or does server something wrong? > > THANK YOU!!! > > Peter > > > public static void main(String[] args) { > String seq = > "TCTAGAAAAATTTTTTAAAAAATTAGGCCGCTCGAGCGAGAGTGCAGTGGCTCACGCCTGTAATCCAACA" + > > "CTTCAGGAGGCTGAAGAGGGTGGATCACCTGAGGTCAGGAGTTCCAGACCAGCCTGGCCAACATGGTGAA"; > > try { > // CONSTRUCT THE SERVICE > > AnalysisServiceService service = new > AnalysisServiceServiceLocator(); > Nucleic_PrimersEprimer3SoapBindingStub primer = > (Nucleic_PrimersEprimer3SoapBindingStub) > service.getNucleic_PrimersEprimer3(); > > // SET UP THE PARAMETERS > HashMap params = new HashMap(); > params.put("sequence_direct_data", seq); > params.put("task", 1); > params.put("numreturn", 100); > > // RUN ePRIMER3 > HashMap result = primer.runAndWaitFor(params); > > String output = (String) result.get("outfile"); > System.out.println(output); > > } catch (RemoteException ex) { > Logger.getLogger(Eprimer3.class.getName()).log(Level.SEVERE, > null, ex); > } catch (Exception ex) { > Logger.getLogger(Eprimer3.class.getName()).log(Level.SEVERE, > null, ex); > } > } > > > > HERE THE MESSAGE:: > > Mar 28, 2008 11:24:07 AM mm_filters.Eprimer3 main > SEVERE: null > AxisFault > faultCode: {http://schemas.xmlsoap.org/soap/envelope/}Server.userException > faultString: java.lang.IllegalArgumentException: Conversion to > SoaplabMap failed: Found an unsupported type 'java.lang.Integer'. > faultActor: null > faultDetail: > hostname: web57-node1.ebi.ac.uk > > java.lang.IllegalArgumentException: Conversion to SoaplabMap failed: > Found an unsupported type 'java.lang.Integer'. > at > org.apache.axis.message.SOAPFaultBuilder.endElement(SOAPFaultBuilder.java:135) > at > org.apache.axis.encoding.DeserializationContextImpl.endElement(DeserializationContextImpl.java:942) > at > org.apache.xerces.parsers.AbstractSAXParser.endElement(Unknown Source) > at > org.apache.xerces.impl.XMLNSDocumentScannerImpl.scanEndElement(Unknown > Source) > at > org.apache.xerces.impl.XMLDocumentFragmentScannerImpl$FragmentContentDispatcher.dispatch(Unknown > Source) > at > org.apache.xerces.impl.XMLDocumentFragmentScannerImpl.scanDocument(Unknown > Source) > at org.apache.xerces.parsers.DTDConfiguration.parse(Unknown Source) > at org.apache.xerces.parsers.DTDConfiguration.parse(Unknown Source) > at org.apache.xerces.parsers.XMLParser.parse(Unknown Source) > at org.apache.xerces.parsers.AbstractSAXParser.parse(Unknown Source) > at javax.xml.parsers.SAXParser.parse(SAXParser.java:375) > at > org.apache.axis.encoding.DeserializationContextImpl.parse(DeserializationContextImpl.java:232) > at org.apache.axis.SOAPPart.getAsSOAPEnvelope(SOAPPart.java:546) > at org.apache.axis.Message.getSOAPEnvelope(Message.java:377) > at org.apache.axis.client.Call.invokeEngine(Call.java:2132) > at org.apache.axis.client.Call.invoke(Call.java:2102) > at org.apache.axis.client.Call.invoke(Call.java:1851) > at org.apache.axis.client.Call.invoke(Call.java:1777) > at org.apache.axis.client.Call.invoke(Call.java:1315) > at > uk.ac.ebi.www.Nucleic_PrimersEprimer3SoapBindingStub.runAndWaitFor(Nucleic_PrimersEprimer3SoapBindingStub.java:435) > at mm_filters.Eprimer3.main(Eprimer3.java:162) > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss From schueffi at mpi-sb.mpg.de Fri Mar 28 08:10:51 2008 From: schueffi at mpi-sb.mpg.de (=?ISO-8859-1?Q?Peter_Sch=FCffler?=) Date: Fri, 28 Mar 2008 13:10:51 +0100 Subject: [EMBOSS] HELP!! ePrimer3 service down? In-Reply-To: <1206705608.12782.27.camel@emboss2.ebi.ac.uk> References: <47ECC7C9.504@mpi-sb.mpg.de> <1206705608.12782.27.camel@emboss2.ebi.ac.uk> Message-ID: <47ECE04B.3040409@mpi-sb.mpg.de> Seems to work. No Error message, and normal output. THANK YOU!!! Mahmut Uludag wrote: > Hi Peter, > > >> But for a while, the service doesn't work (but has worked before!). >> > > Can you please try running the service again? We recently moved the > server to Soaplab-2 where we have some changes in the generic input > maps. I have checked in a fix for this problem and updated the server > and will later discuss this issue with Martin for a proper fix that > might go into the soaplab-2 code base. > > Regards, > Mahmut > > > >> Here my source code and the failure message from Java. >> >> Do I something wrong, or does server something wrong? >> >> THANK YOU!!! >> >> Peter >> >> >> public static void main(String[] args) { >> String seq = >> "TCTAGAAAAATTTTTTAAAAAATTAGGCCGCTCGAGCGAGAGTGCAGTGGCTCACGCCTGTAATCCAACA" + >> >> "CTTCAGGAGGCTGAAGAGGGTGGATCACCTGAGGTCAGGAGTTCCAGACCAGCCTGGCCAACATGGTGAA"; >> >> try { >> // CONSTRUCT THE SERVICE >> >> AnalysisServiceService service = new >> AnalysisServiceServiceLocator(); >> Nucleic_PrimersEprimer3SoapBindingStub primer = >> (Nucleic_PrimersEprimer3SoapBindingStub) >> service.getNucleic_PrimersEprimer3(); >> >> // SET UP THE PARAMETERS >> HashMap params = new HashMap(); >> params.put("sequence_direct_data", seq); >> params.put("task", 1); >> params.put("numreturn", 100); >> >> // RUN ePRIMER3 >> HashMap result = primer.runAndWaitFor(params); >> >> String output = (String) result.get("outfile"); >> System.out.println(output); >> >> } catch (RemoteException ex) { >> Logger.getLogger(Eprimer3.class.getName()).log(Level.SEVERE, >> null, ex); >> } catch (Exception ex) { >> Logger.getLogger(Eprimer3.class.getName()).log(Level.SEVERE, >> null, ex); >> } >> } >> >> >> >> HERE THE MESSAGE:: >> >> Mar 28, 2008 11:24:07 AM mm_filters.Eprimer3 main >> SEVERE: null >> AxisFault >> faultCode: {http://schemas.xmlsoap.org/soap/envelope/}Server.userException >> faultString: java.lang.IllegalArgumentException: Conversion to >> SoaplabMap failed: Found an unsupported type 'java.lang.Integer'. >> faultActor: null >> faultDetail: >> hostname: web57-node1.ebi.ac.uk >> >> java.lang.IllegalArgumentException: Conversion to SoaplabMap failed: >> Found an unsupported type 'java.lang.Integer'. >> at >> org.apache.axis.message.SOAPFaultBuilder.endElement(SOAPFaultBuilder.java:135) >> at >> org.apache.axis.encoding.DeserializationContextImpl.endElement(DeserializationContextImpl.java:942) >> at >> org.apache.xerces.parsers.AbstractSAXParser.endElement(Unknown Source) >> at >> org.apache.xerces.impl.XMLNSDocumentScannerImpl.scanEndElement(Unknown >> Source) >> at >> org.apache.xerces.impl.XMLDocumentFragmentScannerImpl$FragmentContentDispatcher.dispatch(Unknown >> Source) >> at >> org.apache.xerces.impl.XMLDocumentFragmentScannerImpl.scanDocument(Unknown >> Source) >> at org.apache.xerces.parsers.DTDConfiguration.parse(Unknown Source) >> at org.apache.xerces.parsers.DTDConfiguration.parse(Unknown Source) >> at org.apache.xerces.parsers.XMLParser.parse(Unknown Source) >> at org.apache.xerces.parsers.AbstractSAXParser.parse(Unknown Source) >> at javax.xml.parsers.SAXParser.parse(SAXParser.java:375) >> at >> org.apache.axis.encoding.DeserializationContextImpl.parse(DeserializationContextImpl.java:232) >> at org.apache.axis.SOAPPart.getAsSOAPEnvelope(SOAPPart.java:546) >> at org.apache.axis.Message.getSOAPEnvelope(Message.java:377) >> at org.apache.axis.client.Call.invokeEngine(Call.java:2132) >> at org.apache.axis.client.Call.invoke(Call.java:2102) >> at org.apache.axis.client.Call.invoke(Call.java:1851) >> at org.apache.axis.client.Call.invoke(Call.java:1777) >> at org.apache.axis.client.Call.invoke(Call.java:1315) >> at >> uk.ac.ebi.www.Nucleic_PrimersEprimer3SoapBindingStub.runAndWaitFor(Nucleic_PrimersEprimer3SoapBindingStub.java:435) >> at mm_filters.Eprimer3.main(Eprimer3.java:162) >> >> >> _______________________________________________ >> EMBOSS mailing list >> EMBOSS at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/emboss >> > > From Sebastien.Moretti at unil.ch Fri Mar 28 08:08:11 2008 From: Sebastien.Moretti at unil.ch (Sebastien Moretti) Date: Fri, 28 Mar 2008 13:08:11 +0100 Subject: [EMBOSS] knowntypes Message-ID: <47ECDFAB.5020902@unil.ch> Hi, Are there 'official' knowntypes for stdout, stderr (outfile) ? And the equivalent of 'dna fasta' for protein infile ? Thanks -- S?bastien Moretti SIB, Quartier Sorge - Genopode CH-1015 Lausanne, Switzerland Tel.: +41 (21) 692 4056/4221 From schueffi at mpi-sb.mpg.de Fri Mar 28 09:17:23 2008 From: schueffi at mpi-sb.mpg.de (=?ISO-8859-1?Q?Peter_Sch=FCffler?=) Date: Fri, 28 Mar 2008 14:17:23 +0100 Subject: [EMBOSS] HELP!! ePrimer3 service down? In-Reply-To: <47ECE04B.3040409@mpi-sb.mpg.de> References: <47ECC7C9.504@mpi-sb.mpg.de> <1206705608.12782.27.camel@emboss2.ebi.ac.uk> <47ECE04B.3040409@mpi-sb.mpg.de> Message-ID: <47ECEFE3.3030203@mpi-sb.mpg.de> Well, it works, but there is a difference: I use the params mintm and maxtm for eprimer3. These values must now be integers (formaly, they were doubles - now, when they are doubles, an Error arises without successful primer findings). Don't now if this concerns also other params... AxisFault faultCode: {http://schemas.xmlsoap.org/soap/envelope/}Server.userException faultString: java.lang.IllegalArgumentException: Conversion to SoaplabMap failed: Found an unsupported type 'java.lang.Double'. faultActor: null faultDetail: hostname: web57-node1.ebi.ac.uk java.lang.IllegalArgumentException: Conversion to SoaplabMap failed: Found an unsupported type 'java.lang.Double'. at org.apache.axis.message.SOAPFaultBuilder.endElement(SOAPFaultBuilder.java:135) at org.apache.axis.encoding.DeserializationContextImpl.endElement(DeserializationContextImpl.java:942) at org.apache.xerces.parsers.AbstractSAXParser.endElement(Unknown Source) at org.apache.xerces.impl.XMLNSDocumentScannerImpl.scanEndElement(Unknown Source) at org.apache.xerces.impl.XMLDocumentFragmentScannerImpl$FragmentContentDispatcher.dispatch(Unknown Source) at org.apache.xerces.impl.XMLDocumentFragmentScannerImpl.scanDocument(Unknown Source) at org.apache.xerces.parsers.DTDConfiguration.parse(Unknown Source) at org.apache.xerces.parsers.DTDConfiguration.parse(Unknown Source) at org.apache.xerces.parsers.XMLParser.parse(Unknown Source) at org.apache.xerces.parsers.AbstractSAXParser.parse(Unknown Source) at javax.xml.parsers.SAXParser.parse(SAXParser.java:375) Peter Sch?ffler wrote: > Seems to work. No Error message, and normal output. > > THANK YOU!!! > > > > > Mahmut Uludag wrote: >> Hi Peter, >> >> >>> But for a while, the service doesn't work (but has worked before!). >>> >> >> Can you please try running the service again? We recently moved the >> server to Soaplab-2 where we have some changes in the generic input >> maps. I have checked in a fix for this problem and updated the server >> and will later discuss this issue with Martin for a proper fix that >> might go into the soaplab-2 code base. >> >> Regards, >> Mahmut >> >> >> >>> Here my source code and the failure message from Java. >>> >>> Do I something wrong, or does server something wrong? >>> >>> THANK YOU!!! >>> >>> Peter >>> >>> >>> public static void main(String[] args) { >>> String seq = >>> "TCTAGAAAAATTTTTTAAAAAATTAGGCCGCTCGAGCGAGAGTGCAGTGGCTCACGCCTGTAATCCAACA" >>> + >>> >>> "CTTCAGGAGGCTGAAGAGGGTGGATCACCTGAGGTCAGGAGTTCCAGACCAGCCTGGCCAACATGGTGAA"; >>> >>> >>> try { >>> // CONSTRUCT THE SERVICE >>> >>> AnalysisServiceService service = new >>> AnalysisServiceServiceLocator(); >>> Nucleic_PrimersEprimer3SoapBindingStub primer = >>> (Nucleic_PrimersEprimer3SoapBindingStub) >>> service.getNucleic_PrimersEprimer3(); >>> // SET UP THE PARAMETERS >>> HashMap params = new HashMap(); >>> params.put("sequence_direct_data", seq); >>> params.put("task", 1); >>> params.put("numreturn", 100); >>> >>> // RUN ePRIMER3 >>> HashMap result = primer.runAndWaitFor(params); >>> >>> String output = (String) result.get("outfile"); >>> System.out.println(output); >>> >>> } catch (RemoteException ex) { >>> >>> Logger.getLogger(Eprimer3.class.getName()).log(Level.SEVERE, null, ex); >>> } catch (Exception ex) { >>> >>> Logger.getLogger(Eprimer3.class.getName()).log(Level.SEVERE, null, ex); >>> } >>> } >>> >>> >>> >>> HERE THE MESSAGE:: >>> >>> Mar 28, 2008 11:24:07 AM mm_filters.Eprimer3 main >>> SEVERE: null >>> AxisFault >>> faultCode: >>> {http://schemas.xmlsoap.org/soap/envelope/}Server.userException >>> faultString: java.lang.IllegalArgumentException: Conversion to >>> SoaplabMap failed: Found an unsupported type 'java.lang.Integer'. >>> faultActor: null >>> faultDetail: >>> hostname: web57-node1.ebi.ac.uk >>> >>> java.lang.IllegalArgumentException: Conversion to SoaplabMap failed: >>> Found an unsupported type 'java.lang.Integer'. >>> at >>> org.apache.axis.message.SOAPFaultBuilder.endElement(SOAPFaultBuilder.java:135) >>> >>> at >>> org.apache.axis.encoding.DeserializationContextImpl.endElement(DeserializationContextImpl.java:942) >>> >>> at >>> org.apache.xerces.parsers.AbstractSAXParser.endElement(Unknown Source) >>> at >>> org.apache.xerces.impl.XMLNSDocumentScannerImpl.scanEndElement(Unknown >>> Source) >>> at >>> org.apache.xerces.impl.XMLDocumentFragmentScannerImpl$FragmentContentDispatcher.dispatch(Unknown >>> Source) >>> at >>> org.apache.xerces.impl.XMLDocumentFragmentScannerImpl.scanDocument(Unknown >>> Source) >>> at org.apache.xerces.parsers.DTDConfiguration.parse(Unknown >>> Source) >>> at org.apache.xerces.parsers.DTDConfiguration.parse(Unknown >>> Source) >>> at org.apache.xerces.parsers.XMLParser.parse(Unknown Source) >>> at org.apache.xerces.parsers.AbstractSAXParser.parse(Unknown >>> Source) >>> at javax.xml.parsers.SAXParser.parse(SAXParser.java:375) >>> at >>> org.apache.axis.encoding.DeserializationContextImpl.parse(DeserializationContextImpl.java:232) >>> >>> at >>> org.apache.axis.SOAPPart.getAsSOAPEnvelope(SOAPPart.java:546) >>> at org.apache.axis.Message.getSOAPEnvelope(Message.java:377) >>> at org.apache.axis.client.Call.invokeEngine(Call.java:2132) >>> at org.apache.axis.client.Call.invoke(Call.java:2102) >>> at org.apache.axis.client.Call.invoke(Call.java:1851) >>> at org.apache.axis.client.Call.invoke(Call.java:1777) >>> at org.apache.axis.client.Call.invoke(Call.java:1315) >>> at >>> uk.ac.ebi.www.Nucleic_PrimersEprimer3SoapBindingStub.runAndWaitFor(Nucleic_PrimersEprimer3SoapBindingStub.java:435) >>> >>> at mm_filters.Eprimer3.main(Eprimer3.java:162) >>> >>> >>> _______________________________________________ >>> EMBOSS mailing list >>> EMBOSS at lists.open-bio.org >>> http://lists.open-bio.org/mailman/listinfo/emboss >>> >> >> > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss From pmr at ebi.ac.uk Fri Mar 28 09:30:44 2008 From: pmr at ebi.ac.uk (Peter Rice) Date: Fri, 28 Mar 2008 13:30:44 +0000 Subject: [EMBOSS] knowntypes In-Reply-To: <47ECDFAB.5020902@unil.ch> References: <47ECDFAB.5020902@unil.ch> Message-ID: <47ECF304.2020707@ebi.ac.uk> Sebastien Moretti wrote: > Are there 'official' knowntypes for stdout, stderr (outfile) ? And > the equivalent of 'dna fasta' for protein infile ? There are official knowntypes for files ... see the knowntypes.standard file in the ACD directory. These are the knowntypes we use in the ACD files. We welcome any suggestions for new types or changes to the existing types. The knowntypes are only used for validation (in acdvalid). We limit the types to try to reuse the same names for matching input and output files in different applications. We will add a "protein fasta" and a "sequence fasta" to the standards file. There is no problem with adding new knowntypes for your own applications, but we like to know which ones are found to be useful so we can make them official EMBOSS standard types too. regards, Peter Rice From uludag at ebi.ac.uk Fri Mar 28 09:44:39 2008 From: uludag at ebi.ac.uk (Mahmut Uludag) Date: Fri, 28 Mar 2008 13:44:39 +0000 Subject: [EMBOSS] HELP!! ePrimer3 service down? In-Reply-To: <47ECEFE3.3030203@mpi-sb.mpg.de> References: <47ECC7C9.504@mpi-sb.mpg.de> <1206705608.12782.27.camel@emboss2.ebi.ac.uk> <47ECE04B.3040409@mpi-sb.mpg.de> <47ECEFE3.3030203@mpi-sb.mpg.de> Message-ID: <1206711879.12782.37.camel@emboss2.ebi.ac.uk> > Well, it works, but there is a difference: > > I use the params mintm and maxtm for eprimer3. These values must now be > integers (formaly, they were doubles - now, when they are doubles, an > Error arises without successful primer findings). I have extended the fix for the type double as well and updated the server. I didn't do it straight away because didn't have time yet to discuss this with Martin. As you pointed we might have problems with other data types as well. Until we have a fix you can use String representation of the values in the input map rather than the actual data types. Regards, Mahmut From Sebastien.Moretti at unil.ch Fri Mar 28 09:51:07 2008 From: Sebastien.Moretti at unil.ch (Sebastien Moretti) Date: Fri, 28 Mar 2008 14:51:07 +0100 Subject: [EMBOSS] knowntypes In-Reply-To: <47ECF304.2020707@ebi.ac.uk> References: <47ECDFAB.5020902@unil.ch> <47ECF304.2020707@ebi.ac.uk> Message-ID: <47ECF7CB.9090305@unil.ch> >> Are there 'official' knowntypes for stdout, stderr (outfile) ? And >> the equivalent of 'dna fasta' for protein infile ? > > There are official knowntypes for files ... see the knowntypes.standard > file in the ACD directory. > > These are the knowntypes we use in the ACD files. We welcome any > suggestions for new types or changes to the existing types. > > The knowntypes are only used for validation (in acdvalid). We limit the > types to try to reuse the same names for matching input and output files > in different applications. > > We will add a "protein fasta" and a "sequence fasta" to the standards file. "Protein fasta" and "sequence fasta" were missing. stdout is less required because it should be the normal program output. But you should add a knowntype for stderr. > There is no problem with adding new knowntypes for your own > applications, but we like to know which ones are found to be useful so > we can make them official EMBOSS standard types too. > > regards, > > Peter Rice Thanks -- S?bastien Moretti SIB, Quartier Sorge - Genopode CH-1015 Lausanne, Switzerland Tel.: +41 (21) 692 4056/4221 From Sebastien.Moretti at unil.ch Fri Mar 28 10:18:03 2008 From: Sebastien.Moretti at unil.ch (Sebastien Moretti) Date: Fri, 28 Mar 2008 15:18:03 +0100 Subject: [EMBOSS] list and label values Message-ID: <47ECFE1B.30109@unil.ch> Hi, I am looking for a way to use labels/alias for values in a list: variable: matrixpath "/usr/molbio/share" list: matrix [ default: "$(matrixpath)/Hs.smat" minimum: 1 maximum: 1 values: "Human:$(matrixpath)/Hs.smat, Arabidopsis:$(matrixpath)/At.smat, Rat:$(matrixpath)/Rn.smat, Drosophila:$(matrixpath)/Dm.smat, Chicken:$(matrixpath)/Gga.smat, Mouse:$(matrixpath)/Mm.smat, Zebrafish:$(matrixpath)/Dr.smat" delimiter: "," codedelimiter: ":" comment: "defaults" prompt: "Score matrices file, species specific" information: "Score matrices file, species specific" ] So, when I select 'Human', I would like that "$(matrixpath)/Hs.smat" appears in command line. How could I do this ? Thanks -- S?bastien Moretti SIB, Quartier Sorge - Genopode CH-1015 Lausanne, Switzerland Tel.: +41 (21) 692 4056/4221 From pmr at ebi.ac.uk Fri Mar 28 11:38:32 2008 From: pmr at ebi.ac.uk (Peter Rice) Date: Fri, 28 Mar 2008 15:38:32 +0000 Subject: [EMBOSS] list and label values In-Reply-To: <47ECFE1B.30109@unil.ch> References: <47ECFE1B.30109@unil.ch> Message-ID: <47ED10F8.1050507@ebi.ac.uk> Sebastien Moretti wrote: > Hi, > > I am looking for a way to use labels/alias for values in a list: For those interested, I will reply on the emboss-dev list. This is a bit technical :-) Peter From Johanne.Duhaime at ircm.qc.ca Mon Mar 31 10:12:50 2008 From: Johanne.Duhaime at ircm.qc.ca (Duhaime Johanne) Date: Mon, 31 Mar 2008 10:12:50 -0400 Subject: [EMBOSS] EmbossExplorer: running problem (or installation problem?) Message-ID: Hello A while ago I sent a message asking for help. Someone guided me (I thank him a lot) but I am still struggling with the installation of Emboss Explorer. I have seeked for documentation but could not find any. I am using this forum since I do not know where else to apply. I wish this is OK. Here is my first question. "index.html" file in my Emboss web directory contains the following: EMBOSS Explorer in my "cgi-bin" I only have "emboss" as a perl program after the installation. How could that work? Of course if I rename emboss by, let's say intro (as in the index.html), it does work. But I have three frames. What am I missing? My second question I want to change the default output for "emma". For this I have put "SET emboss_OUTFORMAT clustal" in my "emboss.default" file. This work perfectly when I use "emma" at the command line. But it has no effect in the EmbossExplorer Interface. Is there a way to correct that? Thank you in advance for the help. It will be appreciate very much. Johanne Duhaime duhaimj at ircm.qc.ca From lcarlo at cs.utah.edu Sat Mar 1 21:52:17 2008 From: lcarlo at cs.utah.edu (Lorena Carlo) Date: Sat, 01 Mar 2008 16:52:17 -0500 Subject: [EMBOSS] newbie, need some guidance with emboss web services Message-ID: <47C9D011.3000606@cs.utah.edu> Hi, I am trying to use EMBOSS web services in a python client. I use ZSI 2.1a library to communicate with the web services. I am trying to use edit.seqret.derived web service: (http://www.ebi.ac.uk/soaplab/emboss4/services/edit.seqret.derived?wsdl). I am sending the following sequence that I found in the EMBOSS tutorial: embl:xlrhodop to the web service. But I am not getting any answer. Bellow I am including some lines of code I am using. Can somebody give me any guidance with this?. Should I use the non derived ones, I prefer to use the derived ones, because the application have support for complex types. #This are the stub files that ZSI generates to manage complex types. from seqretService_client import * from seqretService_types import * #This are in the stub files and allow you to call the methods inside the web service loc = seqretServiceLocator() port = loc.getedit__seqret() req1 = createAndRunRequest() reqseqret1 = req1.new_seqret() reqsequence1 = reqseqret1.new_sequence() reqsequence1.set_element_sequence_usa('embl:xlrhodop') reqseqret1.Sequence = reqsequence1 req1.Seqret = reqseqret1 resp1 = port.createAndRun(req1) jobid = resp1.Jobid print jobid edit.seqret/-11701ee7:11864847959:3072 waitforReq = waitForRequest() waitforReq.set_element_jobid(jobid) resp2 = port.waitFor(waitforReq) reqresults = getResultsRequest() reqresults.set_element_jobid(jobid) response = port.getResults(reqresults) seqretresult = response.get_element_seqretResult() print seqretresult.get_element_report() None print seqretresult.get_element_outseq() None print seqretresult.get_element_detailed_status() None BTW: I have also used the runAndWaitFor method but I obtain the same result (None). Thanks! Lorena From lcarlo at cs.utah.edu Sat Mar 1 22:00:05 2008 From: lcarlo at cs.utah.edu (Lorena Carlo) Date: Sat, 01 Mar 2008 17:00:05 -0500 Subject: [EMBOSS] newbie, need some guidance with emboss web services Message-ID: <47C9D1E5.1050900@cs.utah.edu> Hi, I am trying to use EMBOSS web services in a python client. I use ZSI 2.1a library to communicate with the web services. I am trying to use edit.seqret.derived web service: (http://www.ebi.ac.uk/soaplab/emboss4/services/edit.seqret.derived?wsdl). I am sending the following sequence that I found in the EMBOSS tutorial: embl:xlrhodop to the web service. But I am not getting any answer. Bellow I am including some lines of code I am using. Can somebody give me any guidance with this?. Should I use the non derived ones, I prefer to use the derived ones, because the application have support for complex types. #This are the stub files that ZSI generates to manage complex types. from seqretService_client import * from seqretService_types import * #This are in the stub files and allow you to call the methods inside the web service loc = seqretServiceLocator() port = loc.getedit__seqret() req1 = createAndRunRequest() reqseqret1 = req1.new_seqret() reqsequence1 = reqseqret1.new_sequence() reqsequence1.set_element_sequence_usa('embl:xlrhodop') reqseqret1.Sequence = reqsequence1 req1.Seqret = reqseqret1 resp1 = port.createAndRun(req1) jobid = resp1.Jobid print jobid edit.seqret/-11701ee7:11864847959:3072 waitforReq = waitForRequest() waitforReq.set_element_jobid(jobid) resp2 = port.waitFor(waitforReq) reqresults = getResultsRequest() reqresults.set_element_jobid(jobid) response = port.getResults(reqresults) seqretresult = response.get_element_seqretResult() print seqretresult.get_element_report() None print seqretresult.get_element_outseq() None print seqretresult.get_element_detailed_status() None BTW: I have also used the runAndWaitFor method but I obtain the same result (None). Thanks! Lorena From lcarlo at cs.utah.edu Tue Mar 4 00:16:24 2008 From: lcarlo at cs.utah.edu (Lorena Carlo) Date: Mon, 03 Mar 2008 17:16:24 -0700 Subject: [EMBOSS] EMBOSS explorer is not working Message-ID: <47CC94D8.1070509@cs.utah.edu> Hi, I just wanted to let you know that EMBOSS explorer is not working. I tested seqret and prettyplot methods and I get the same message: "I can't run a live demo on the Sourceforge server. I hope to solve this problem soon". Please let me know when you fix it. Thanks, Lorena From uludag at ebi.ac.uk Tue Mar 4 16:57:12 2008 From: uludag at ebi.ac.uk (Mahmut Uludag) Date: Tue, 04 Mar 2008 16:57:12 +0000 Subject: [EMBOSS] newbie, need some guidance with emboss web services In-Reply-To: <47C9D011.3000606@cs.utah.edu> References: <47C9D011.3000606@cs.utah.edu> Message-ID: <1204649832.2439.27.camel@emboss2.ebi.ac.uk> Hi Lorena, I have used Eclipse TCP/IP-Monitor to check the data transfer between your client program and the Soaplab services. The correct server response to the getResults call is definitely received by the client program but I'm not able to find out why the attributes of the response object are empty in your client program. As you may have noticed I asked help from two colleagues that I know they have python webservices experience. If I hear anything from them then will let you know. Regards, Mahmut On Sat, 2008-03-01 at 16:52 -0500, Lorena Carlo wrote: > Hi, > > I am trying to use EMBOSS web services in a python client. I use ZSI > 2.1a library to communicate with the web services. I am trying to use > edit.seqret.derived web service: > (http://www.ebi.ac.uk/soaplab/emboss4/services/edit.seqret.derived?wsdl). > I am sending the following sequence that I found in the EMBOSS tutorial: > embl:xlrhodop to the web service. But I am not getting any answer. > Bellow I am including some lines of code I am using. Can somebody give > me any guidance with this?. Should I use the non derived ones, I > prefer to use the derived ones, because the application have support for > complex types. > > > > #This are the stub files that ZSI generates to manage complex types. > from seqretService_client import * > from seqretService_types import * > > #This are in the stub files and allow you to call the methods inside the > web service > loc = seqretServiceLocator() > port = loc.getedit__seqret() > > req1 = createAndRunRequest() > reqseqret1 = req1.new_seqret() > reqsequence1 = reqseqret1.new_sequence() > reqsequence1.set_element_sequence_usa('embl:xlrhodop') > reqseqret1.Sequence = reqsequence1 > req1.Seqret = reqseqret1 > resp1 = port.createAndRun(req1) > > jobid = resp1.Jobid > print jobid > edit.seqret/-11701ee7:11864847959:3072 > > waitforReq = waitForRequest() > waitforReq.set_element_jobid(jobid) > > resp2 = port.waitFor(waitforReq) > > reqresults = getResultsRequest() > reqresults.set_element_jobid(jobid) > response = port.getResults(reqresults) > seqretresult = response.get_element_seqretResult() > print seqretresult.get_element_report() > None > print seqretresult.get_element_outseq() > None > print seqretresult.get_element_detailed_status() > None > > BTW: I have also used the runAndWaitFor method but I obtain the same > result (None). > > Thanks! > > Lorena > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss From staffa at niehs.nih.gov Tue Mar 4 19:32:33 2008 From: staffa at niehs.nih.gov (Staffa, Nick (NIH/NIEHS)) Date: Tue, 04 Mar 2008 14:32:33 -0500 Subject: [EMBOSS] Jemboss In-Reply-To: <1204649832.2439.27.camel@emboss2.ebi.ac.uk> Message-ID: Does anyone out there use Jemboss? Must one always invoke a web URL to get it running every time he wants to use it? or is that just one way to set it up? Nick Staffa Telephone: 919-316-4569 (NIEHS: 6-4569) Scientific Computing Support Group NIEHS Information Technology Support Services Contract (Science Task Monitor: Roy W. Reter (reter at niehs.nih.gov) National Institute of Environmental Health Sciences National Institutes of Health Research Triangle Park, North Carolina From uludag at ebi.ac.uk Thu Mar 6 20:08:33 2008 From: uludag at ebi.ac.uk (uludag at ebi.ac.uk) Date: Thu, 6 Mar 2008 20:08:33 -0000 (GMT) Subject: [EMBOSS] newbie, need some guidance with emboss web services In-Reply-To: <1204649832.2439.27.camel@emboss2.ebi.ac.uk> References: <47C9D011.3000606@cs.utah.edu> <1204649832.2439.27.camel@emboss2.ebi.ac.uk> Message-ID: <37303.81.156.216.123.1204834113.squirrel@webmail.ebi.ac.uk> Hi Lorena, > As you may have noticed I asked help from two colleagues that I know > they have python webservices experience. If I hear anything from them > then will let you know. Jan Christan from The EMBRACE project suggested to check the output from the service using Soapui's output validation support. Soapui let to see a problem in the service output. This problem is now fixed and your test script now prints the service results correctly. Regards, Mahmut From lcarlo at cs.utah.edu Thu Mar 6 22:14:08 2008 From: lcarlo at cs.utah.edu (Lorena Carlo) Date: Thu, 06 Mar 2008 15:14:08 -0700 Subject: [EMBOSS] broken links for EMBOSS web services Message-ID: <47D06CB0.4050608@cs.utah.edu> Hello, There are problem with some links: http://www.ebi.ac.uk/soaplab/emboss4/servlet/AxisServlet and http://www.ebi.ac.uk/soaplab/emboss4/services/alignment_multiple.prettyplot.derived?wsdl, it think the problem is displaying the wsdl of the derived web services. * To see the available web services and their methods, I get the following error: And now... Some Services AXIS error Sorry, something seems to have gone wrong... here are the details: Fault - Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse AxisFault faultCode: {http://schemas.xmlsoap.org/soap/envelope/}Server.generalException faultSubcode: faultString: Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse faultActor: faultNode: faultDetail: {http://xml.apache.org/axis/}hostname:web57-node1.ebi.ac.uk * And the web services wsdl description have the following problem: AXIS error Sorry, something seems to have gone wrong... here are the details: Fault - Failed to determine deployed service names.; nested exception is: org.apache.axis.ConfigurationException: Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse AxisFault faultCode: {http://schemas.xmlsoap.org/soap/envelope/}Server.generalException faultSubcode: faultString: Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse faultActor: faultNode: faultDetail: {http://xml.apache.org/axis/}hostname:web57-node1.ebi.ac.uk Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse at org.apache.axis.providers.java.JavaProvider.getServiceClass(JavaProvider.java:432) at org.apache.axis.providers.java.JavaProvider.initServiceDesc(JavaProvider.java:461) at org.apache.axis.handlers.soap.SOAPService.getInitializedServiceDesc(SOAPService.java:286) at org.apache.axis.deployment.wsdd.WSDDService.makeNewInstance(WSDDService.java:500) at org.apache.axis.deployment.wsdd.WSDDDeployment.getDeployedServices(WSDDDeployment.java:503) at org.apache.axis.configuration.FileProvider.getDeployedServices(FileProvider.java:296) at org.apache.axis.transport.http.QSWSDLHandler.getDeployedServiceNames(QSWSDLHandler.java:218) at org.apache.axis.transport.http.QSWSDLHandler.updateSoapAddressLocationURLs(QSWSDLHandler.java:153) at org.apache.axis.transport.http.QSWSDLHandler.invoke(QSWSDLHandler.java:72) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.axis.transport.http.AxisServlet.processQuery(AxisServlet.java:1226) at org.apache.axis.transport.http.AxisServlet.doGet(AxisServlet.java:249) at javax.servlet.http.HttpServlet.service(HttpServlet.java:689) at org.apache.axis.transport.http.AxisServletBase.service(AxisServletBase.java:327) at javax.servlet.http.HttpServlet.service(HttpServlet.java:802) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:252) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:173) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:213) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:178) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:126) at org.apache.catalina.valves.ErrorReportValve.invoke(ErrorReportValve.java:105) at org.apache.catalina.core.StandardEngineValve.invoke(StandardEngineValve.java:107) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:148) at org.apache.jk.server.JkCoyoteHandler.invoke(JkCoyoteHandler.java:199) at org.apache.jk.common.HandlerRequest.invoke(HandlerRequest.java:282) at org.apache.jk.common.ChannelSocket.invoke(ChannelSocket.java:767) at org.apache.jk.common.ChannelSocket.processConnection(ChannelSocket.java:697) at org.apache.jk.common.ChannelSocket$SocketConnection.runIt(ChannelSocket.java:889) at org.apache.tomcat.util.threads.ThreadPool$ControlRunnable.run(ThreadPool.java:684) at java.lang.Thread.run(Thread.java:619) Caused by: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse at org.apache.catalina.loader.WebappClassLoader.loadClass(WebappClassLoader.java:1355) at org.apache.catalina.loader.WebappClassLoader.loadClass(WebappClassLoader.java:1201) at org.apache.axis.utils.ClassUtils$2.run(ClassUtils.java:187) at java.security.AccessController.doPrivileged(Native Method) at org.apache.axis.utils.ClassUtils.loadClass(ClassUtils.java:160) at org.apache.axis.utils.ClassUtils.forName(ClassUtils.java:142) at org.apache.axis.utils.cache.ClassCache.lookup(ClassCache.java:85) at org.apache.axis.providers.java.JavaProvider.getServiceClass(JavaProvider.java:428) ... 32 more org.apache.axis.ConfigurationException: Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse AxisFault faultCode: {http://schemas.xmlsoap.org/soap/envelope/}Server.generalException faultSubcode: faultString: Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse faultActor: faultNode: faultDetail: {http://xml.apache.org/axis/}hostname:web57-node1.ebi.ac.uk Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse at org.apache.axis.providers.java.JavaProvider.getServiceClass(JavaProvider.java:432) at org.apache.axis.providers.java.JavaProvider.initServiceDesc(JavaProvider.java:461) at org.apache.axis.handlers.soap.SOAPService.getInitializedServiceDesc(SOAPService.java:286) at org.apache.axis.deployment.wsdd.WSDDService.makeNewInstance(WSDDService.java:500) at org.apache.axis.deployment.wsdd.WSDDDeployment.getDeployedServices(WSDDDeployment.java:503) at org.apache.axis.configuration.FileProvider.getDeployedServices(FileProvider.java:296) at org.apache.axis.transport.http.QSWSDLHandler.getDeployedServiceNames(QSWSDLHandler.java:218) at org.apache.axis.transport.http.QSWSDLHandler.updateSoapAddressLocationURLs(QSWSDLHandler.java:153) at org.apache.axis.transport.http.QSWSDLHandler.invoke(QSWSDLHandler.java:72) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.axis.transport.http.AxisServlet.processQuery(AxisServlet.java:1226) at org.apache.axis.transport.http.AxisServlet.doGet(AxisServlet.java:249) at javax.servlet.http.HttpServlet.service(HttpServlet.java:689) at org.apache.axis.transport.http.AxisServletBase.service(AxisServletBase.java:327) at javax.servlet.http.HttpServlet.service(HttpServlet.java:802) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:252) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:173) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:213) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:178) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:126) at org.apache.catalina.valves.ErrorReportValve.invoke(ErrorReportValve.java:105) at org.apache.catalina.core.StandardEngineValve.invoke(StandardEngineValve.java:107) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:148) at org.apache.jk.server.JkCoyoteHandler.invoke(JkCoyoteHandler.java:199) at org.apache.jk.common.HandlerRequest.invoke(HandlerRequest.java:282) at org.apache.jk.common.ChannelSocket.invoke(ChannelSocket.java:767) at org.apache.jk.common.ChannelSocket.processConnection(ChannelSocket.java:697) at org.apache.jk.common.ChannelSocket$SocketConnection.runIt(ChannelSocket.java:889) at org.apache.tomcat.util.threads.ThreadPool$ControlRunnable.run(ThreadPool.java:684) at java.lang.Thread.run(Thread.java:619) Caused by: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse at org.apache.catalina.loader.WebappClassLoader.loadClass(WebappClassLoader.java:1355) at org.apache.catalina.loader.WebappClassLoader.loadClass(WebappClassLoader.java:1201) at org.apache.axis.utils.ClassUtils$2.run(ClassUtils.java:187) at java.security.AccessController.doPrivileged(Native Method) at org.apache.axis.utils.ClassUtils.loadClass(ClassUtils.java:160) at org.apache.axis.utils.ClassUtils.forName(ClassUtils.java:142) at org.apache.axis.utils.cache.ClassCache.lookup(ClassCache.java:85) at org.apache.axis.providers.java.JavaProvider.getServiceClass(JavaProvider.java:428) ... 32 more at org.apache.axis.deployment.wsdd.WSDDService.makeNewInstance(WSDDService.java:502) at org.apache.axis.deployment.wsdd.WSDDDeployment.getDeployedServices(WSDDDeployment.java:503) at org.apache.axis.configuration.FileProvider.getDeployedServices(FileProvider.java:296) at org.apache.axis.transport.http.QSWSDLHandler.getDeployedServiceNames(QSWSDLHandler.java:218) at org.apache.axis.transport.http.QSWSDLHandler.updateSoapAddressLocationURLs(QSWSDLHandler.java:153) at org.apache.axis.transport.http.QSWSDLHandler.invoke(QSWSDLHandler.java:72) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.axis.transport.http.AxisServlet.processQuery(AxisServlet.java:1226) at org.apache.axis.transport.http.AxisServlet.doGet(AxisServlet.java:249) at javax.servlet.http.HttpServlet.service(HttpServlet.java:689) at org.apache.axis.transport.http.AxisServletBase.service(AxisServletBase.java:327) at javax.servlet.http.HttpServlet.service(HttpServlet.java:802) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:252) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:173) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:213) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:178) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:126) at org.apache.catalina.valves.ErrorReportValve.invoke(ErrorReportValve.java:105) at org.apache.catalina.core.StandardEngineValve.invoke(StandardEngineValve.java:107) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:148) at org.apache.jk.server.JkCoyoteHandler.invoke(JkCoyoteHandler.java:199) at org.apache.jk.common.HandlerRequest.invoke(HandlerRequest.java:282) at org.apache.jk.common.ChannelSocket.invoke(ChannelSocket.java:767) at org.apache.jk.common.ChannelSocket.processConnection(ChannelSocket.java:697) at org.apache.jk.common.ChannelSocket$SocketConnection.runIt(ChannelSocket.java:889) at org.apache.tomcat.util.threads.ThreadPool$ControlRunnable.run(ThreadPool.java:684) at java.lang.Thread.run(Thread.java:619) AxisFault faultCode: {http://schemas.xmlsoap.org/soap/envelope/}Server.generalException faultSubcode: faultString: Failed to determine deployed service names.; nested exception is: org.apache.axis.ConfigurationException: Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse AxisFault faultCode: {http://schemas.xmlsoap.org/soap/envelope/}Server.generalException faultSubcode: faultString: Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse faultActor: faultNode: faultDetail: {http://xml.apache.org/axis/}hostname:web57-node1.ebi.ac.uk Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse at org.apache.axis.providers.java.JavaProvider.getServiceClass(JavaProvider.java:432) at org.apache.axis.providers.java.JavaProvider.initServiceDesc(JavaProvider.java:461) at org.apache.axis.handlers.soap.SOAPService.getInitializedServiceDesc(SOAPService.java:286) at org.apache.axis.deployment.wsdd.WSDDService.makeNewInstance(WSDDService.java:500) at org.apache.axis.deployment.wsdd.WSDDDeployment.getDeployedServices(WSDDDeployment.java:503) at org.apache.axis.configuration.FileProvider.getDeployedServices(FileProvider.java:296) at org.apache.axis.transport.http.QSWSDLHandler.getDeployedServiceNames(QSWSDLHandler.java:218) at org.apache.axis.transport.http.QSWSDLHandler.updateSoapAddressLocationURLs(QSWSDLHandler.java:153) at org.apache.axis.transport.http.QSWSDLHandler.invoke(QSWSDLHandler.java:72) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.axis.transport.http.AxisServlet.processQuery(AxisServlet.java:1226) at org.apache.axis.transport.http.AxisServlet.doGet(AxisServlet.java:249) at javax.servlet.http.HttpServlet.service(HttpServlet.java:689) at org.apache.axis.transport.http.AxisServletBase.service(AxisServletBase.java:327) at javax.servlet.http.HttpServlet.service(HttpServlet.java:802) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:252) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:173) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:213) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:178) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:126) at org.apache.catalina.valves.ErrorReportValve.invoke(ErrorReportValve.java:105) at org.apache.catalina.core.StandardEngineValve.invoke(StandardEngineValve.java:107) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:148) at org.apache.jk.server.JkCoyoteHandler.invoke(JkCoyoteHandler.java:199) at org.apache.jk.common.HandlerRequest.invoke(HandlerRequest.java:282) at org.apache.jk.common.ChannelSocket.invoke(ChannelSocket.java:767) at org.apache.jk.common.ChannelSocket.processConnection(ChannelSocket.java:697) at org.apache.jk.common.ChannelSocket$SocketConnection.runIt(ChannelSocket.java:889) at org.apache.tomcat.util.threads.ThreadPool$ControlRunnable.run(ThreadPool.java:684) at java.lang.Thread.run(Thread.java:619) Caused by: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse at org.apache.catalina.loader.WebappClassLoader.loadClass(WebappClassLoader.java:1355) at org.apache.catalina.loader.WebappClassLoader.loadClass(WebappClassLoader.java:1201) at org.apache.axis.utils.ClassUtils$2.run(ClassUtils.java:187) at java.security.AccessController.doPrivileged(Native Method) at org.apache.axis.utils.ClassUtils.loadClass(ClassUtils.java:160) at org.apache.axis.utils.ClassUtils.forName(ClassUtils.java:142) at org.apache.axis.utils.cache.ClassCache.lookup(ClassCache.java:85) at org.apache.axis.providers.java.JavaProvider.getServiceClass(JavaProvider.java:428) ... 32 more org.apache.axis.ConfigurationException: Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse AxisFault faultCode: {http://schemas.xmlsoap.org/soap/envelope/}Server.generalException faultSubcode: faultString: Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse faultActor: faultNode: faultDetail: {http://xml.apache.org/axis/}hostname:web57-node1.ebi.ac.uk Could not find class for the service named: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse Hint: you may need to copy your class files/tree into the right location (which depends on the servlet system you are using).; nested exception is: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse at org.apache.axis.providers.java.JavaProvider.getServiceClass(JavaProvider.java:432) at org.apache.axis.providers.java.JavaProvider.initServiceDesc(JavaProvider.java:461) at org.apache.axis.handlers.soap.SOAPService.getInitializedServiceDesc(SOAPService.java:286) at org.apache.axis.deployment.wsdd.WSDDService.makeNewInstance(WSDDService.java:500) at org.apache.axis.deployment.wsdd.WSDDDeployment.getDeployedServices(WSDDDeployment.java:503) at org.apache.axis.configuration.FileProvider.getDeployedServices(FileProvider.java:296) at org.apache.axis.transport.http.QSWSDLHandler.getDeployedServiceNames(QSWSDLHandler.java:218) at org.apache.axis.transport.http.QSWSDLHandler.updateSoapAddressLocationURLs(QSWSDLHandler.java:153) at org.apache.axis.transport.http.QSWSDLHandler.invoke(QSWSDLHandler.java:72) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.axis.transport.http.AxisServlet.processQuery(AxisServlet.java:1226) at org.apache.axis.transport.http.AxisServlet.doGet(AxisServlet.java:249) at javax.servlet.http.HttpServlet.service(HttpServlet.java:689) at org.apache.axis.transport.http.AxisServletBase.service(AxisServletBase.java:327) at javax.servlet.http.HttpServlet.service(HttpServlet.java:802) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:252) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:173) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:213) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:178) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:126) at org.apache.catalina.valves.ErrorReportValve.invoke(ErrorReportValve.java:105) at org.apache.catalina.core.StandardEngineValve.invoke(StandardEngineValve.java:107) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:148) at org.apache.jk.server.JkCoyoteHandler.invoke(JkCoyoteHandler.java:199) at org.apache.jk.common.HandlerRequest.invoke(HandlerRequest.java:282) at org.apache.jk.common.ChannelSocket.invoke(ChannelSocket.java:767) at org.apache.jk.common.ChannelSocket.processConnection(ChannelSocket.java:697) at org.apache.jk.common.ChannelSocket$SocketConnection.runIt(ChannelSocket.java:889) at org.apache.tomcat.util.threads.ThreadPool$ControlRunnable.run(ThreadPool.java:684) at java.lang.Thread.run(Thread.java:619) Caused by: java.lang.ClassNotFoundException: org.embl.ebi.SoaplabServer.applab.derived.utils_database_creation.hetparse.utils_database_creation__hetparse at org.apache.catalina.loader.WebappClassLoader.loadClass(WebappClassLoader.java:1355) at org.apache.catalina.loader.WebappClassLoader.loadClass(WebappClassLoader.java:1201) at org.apache.axis.utils.ClassUtils$2.run(ClassUtils.java:187) at java.security.AccessController.doPrivileged(Native Method) at org.apache.axis.utils.ClassUtils.loadClass(ClassUtils.java:160) at org.apache.axis.utils.ClassUtils.forName(ClassUtils.java:142) at org.apache.axis.utils.cache.ClassCache.lookup(ClassCache.java:85) at org.apache.axis.providers.java.JavaProvider.getServiceClass(JavaProvider.java:428) ... 32 more at org.apache.axis.deployment.wsdd.WSDDService.makeNewInstance(WSDDService.java:502) at org.apache.axis.deployment.wsdd.WSDDDeployment.getDeployedServices(WSDDDeployment.java:503) at org.apache.axis.configuration.FileProvider.getDeployedServices(FileProvider.java:296) at org.apache.axis.transport.http.QSWSDLHandler.getDeployedServiceNames(QSWSDLHandler.java:218) at org.apache.axis.transport.http.QSWSDLHandler.updateSoapAddressLocationURLs(QSWSDLHandler.java:153) at org.apache.axis.transport.http.QSWSDLHandler.invoke(QSWSDLHandler.java:72) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.axis.transport.http.AxisServlet.processQuery(AxisServlet.java:1226) at org.apache.axis.transport.http.AxisServlet.doGet(AxisServlet.java:249) at javax.servlet.http.HttpServlet.service(HttpServlet.java:689) at org.apache.axis.transport.http.AxisServletBase.service(AxisServletBase.java:327) at javax.servlet.http.HttpServlet.service(HttpServlet.java:802) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:252) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:173) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:213) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:178) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:126) at org.apache.catalina.valves.ErrorReportValve.invoke(ErrorReportValve.java:105) at org.apache.catalina.core.StandardEngineValve.invoke(StandardEngineValve.java:107) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:148) at org.apache.jk.server.JkCoyoteHandler.invoke(JkCoyoteHandler.java:199) at org.apache.jk.common.HandlerRequest.invoke(HandlerRequest.java:282) at org.apache.jk.common.ChannelSocket.invoke(ChannelSocket.java:767) at org.apache.jk.common.ChannelSocket.processConnection(ChannelSocket.java:697) at org.apache.jk.common.ChannelSocket$SocketConnection.runIt(ChannelSocket.java:889) at org.apache.tomcat.util.threads.ThreadPool$ControlRunnable.run(ThreadPool.java:684) at java.lang.Thread.run(Thread.java:619) faultActor: faultNode: faultDetail: {http://xml.apache.org/axis/}hostname:web57-node1.ebi.ac.uk From uludag at ebi.ac.uk Thu Mar 6 22:45:13 2008 From: uludag at ebi.ac.uk (uludag at ebi.ac.uk) Date: Thu, 6 Mar 2008 22:45:13 -0000 (GMT) Subject: [EMBOSS] broken links for EMBOSS web services In-Reply-To: <47D06CB0.4050608@cs.utah.edu> References: <47D06CB0.4050608@cs.utah.edu> Message-ID: <49965.81.156.216.123.1204843513.squirrel@webmail.ebi.ac.uk> Hi Lorena, > There are problem with some links: > http://www.ebi.ac.uk/soaplab/emboss4/servlet/AxisServlet The links are now back to Normal. Regards, Mahmut From staffa at niehs.nih.gov Mon Mar 10 15:50:40 2008 From: staffa at niehs.nih.gov (Staffa, Nick (NIH/NIEHS)) Date: Mon, 10 Mar 2008 11:50:40 -0400 Subject: [EMBOSS] Databases Message-ID: We are making a gradual transition from GCG to EMBOSS. Please point me to some explicit instructions for making GCG databases accesable to EMBOSS/Jemboss Thank you Nick Staffa Telephone: 919-316-4569 (NIEHS: 6-4569) Scientific Computing Support Group NIEHS Information Technology Support Services Contract (Science Task Monitor: Roy W. Reter (reter at niehs.nih.gov) National Institute of Environmental Health Sciences National Institutes of Health Research Triangle Park, North Carolina From pmr at ebi.ac.uk Mon Mar 10 16:22:02 2008 From: pmr at ebi.ac.uk (Peter Rice) Date: Mon, 10 Mar 2008 16:22:02 +0000 Subject: [EMBOSS] Databases In-Reply-To: References: Message-ID: <47D5602A.90309@ebi.ac.uk> Dear Nick, Staffa, Nick (NIH/NIEHS) wrote: > We are making a gradual transition from GCG to EMBOSS. > Please point me to some explicit instructions for making GCG databases > accesable to EMBOSS/Jemboss EMBOSS has two database indexing applications for GCG databases: dbxgcg and the older dbigcg. There is a fix for release 5.0.0 for changes to the sayntax of GCG database ID lines. This assumes you are still planning to maintain GCG databases - though I understand UniProt broke GCG recently by having records longer than 255 characters. EMBOSS can also index the native flatfiles with dbxflat, and FASTA files with dbxfasta. With databases indexed in dbxgcg the database definitions look like: DB gcgnuc [ type: N method: embossgcg format: embl directory: "/homes/pmr/data/gcg/gcg_data" indexdir: "/homes/pmr/gcg/index" ] format refers to the text part of the entry (the REF file) With databases indexed in the older dbigcg the database definitions look similar. Change "embossgcg" to "gcg" for the method. Let us know if you ave any more questions. Peter From shrish at ccmb.res.in Fri Mar 14 08:45:26 2008 From: shrish at ccmb.res.in (Shrish Tiwari) Date: Fri, 14 Mar 2008 14:15:26 +0530 (IST) Subject: [EMBOSS] help Message-ID: <32925720.1205484326500.JavaMail.root@127.0.0.1> An embedded and charset-unspecified text was scrubbed... Name: not available URL: From uludag at ebi.ac.uk Fri Mar 14 10:18:57 2008 From: uludag at ebi.ac.uk (Mahmut Uludag) Date: Fri, 14 Mar 2008 10:18:57 +0000 Subject: [EMBOSS] help In-Reply-To: <32925720.1205484326500.JavaMail.root@127.0.0.1> References: <32925720.1205484326500.JavaMail.root@127.0.0.1> Message-ID: <1205489937.3630.22.camel@emboss2.ebi.ac.uk> Hi, > I installed EMBOSS 10.0 on an OPENSUSE Linux machine. I did a make > install in the end to move stuff to the usr/local/bin folder so that > the programs are accessible to everyone. Now when I give the path from > where EMBOSS was installed, the programs run, e.g. > /usr/local/EMBOSS/EMBOSS-2.10.0/emboss/wossname runs fine > But when I type just wossname I get the following error: > shrish at genesys:~> wossname > wossname: error while loading shared libraries: libnucleus.so.0: > cannot open shared object file: No such file or directory > Where did I go wrong? I have installed EMBOSS earlier on other > versions of Unix and Linux, without any hassles. I think it would help you understand the problem if you first know which wossname is executed (call 'which wossname' to learn it), then using the 'ldd' command you can check which shared libraries that wossname executable is using. If you don't have specific reasons it is always better to install the latest stable release of EMBOSS, which is EMBOSS-5.0.0 Regards, Mahmut From ajb at ebi.ac.uk Fri Mar 14 10:37:42 2008 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Fri, 14 Mar 2008 10:37:42 -0000 (GMT) Subject: [EMBOSS] help In-Reply-To: <32925720.1205484326500.JavaMail.root@127.0.0.1> References: <32925720.1205484326500.JavaMail.root@127.0.0.1> Message-ID: <51369.86.14.232.77.1205491062.squirrel@webmail.ebi.ac.uk> This has been reported before but we've never been able to reproduce it. It seems to be limited to just some SuSE systems. As you've installed to /usr/local then the binaries will be in /usr/local/bin and the libraries in /usr/local/lib. So, there are two ways you can get things to work. a) Add /usr/local/lib to your LD_LIBRARY_PATH environment variable e.g. export LD_LIBRARY_PATH=/usr/local/lib:$LD_LIBRARY_PATH b) Add the line: /usr/local/lib to your system /etc/ld.so.conf file and then type "ldconfig" [In order for this change to work you may need to restart the computer] I should also point out that version 2.10.0 of EMBOSS is rather out of date. The current version is 5.0.0 - it will have a newer version of 'libtool' incorporated which may or may not solve this feature of SuSE. Alan > Hi! > I installed EMBOSS 10.0 on an OPENSUSE Linux machine. I did a make install > in the end to move stuff to the usr/local/bin folder so that the programs > are accessible to everyone. Now when I give the path from where EMBOSS was > installed, the programs run, e.g. > /usr/local/EMBOSS/EMBOSS-2.10.0/emboss/wossname runs fine > But when I type just wossname I get the following error: > shrish at genesys:~> wossname > wossname: error while loading shared libraries: libnucleus.so.0: cannot > open shared object file: No such file or directory > Where did I go wrong? I have installed EMBOSS earlier on other versions of > Unix and Linux, without any hassles. > Shrish > Dr. Shrish Tiwari > E503, Centre for Cellular and Molecular Biology > Uppal Road, Hyderabad - 500 007, INDIA > Phone: 91-40-27192777 > Alternate email: shrish.geo at yahoo.com > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From Sebastien.Moretti at unil.ch Fri Mar 14 14:23:57 2008 From: Sebastien.Moretti at unil.ch (Sebastien Moretti) Date: Fri, 14 Mar 2008 15:23:57 +0100 Subject: [EMBOSS] ACD syntax error for infile Message-ID: <47DA8A7D.2010005@unil.ch> Hello, I try to build my own ACD file for one of our application but acdvalid returns a strange error message: Warning: File tmpred.acd line 26: Information string for 'in' not standard 'Sequence file' Error: File tmpred.acd line 26: First input file 'in' is not a parameter Warning: File tmpred.acd line 26: Infile qualifier 'in' is not 'infile' or '*file'(should be 'infile') Here is the problematic section: section: input [ information: "Input section" type: "page" ] infile: in [ standard: "Y" knowntype: "sequence data" prompt: "Name of Sequence (in arbitrary format)" information: "Protein Sequence or Accession number input" ] ... Do you know how to resolve this ? (I use EMBOSS 5.0.0) Thanks -- S?bastien Moretti SIB, Quartier Sorge - Genopode CH-1015 Lausanne, Switzerland Tel.: +41 (21) 692 4056/4221 From ajb at ebi.ac.uk Fri Mar 14 15:38:41 2008 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Fri, 14 Mar 2008 15:38:41 -0000 (GMT) Subject: [EMBOSS] ACD syntax error for infile In-Reply-To: <47DA8A7D.2010005@unil.ch> References: <47DA8A7D.2010005@unil.ch> Message-ID: <59819.86.14.232.77.1205509121.squirrel@webmail.ebi.ac.uk> The error message is, in this case, rather helpful. Just change 'standard' to 'parameter'. The rationale for this is that the first input file in an ACD file should usually be a 'parameter' to enable people to just specify the filename (without qualifier switch) on the command line. acdvalid will just give warnings for subsequent files that aren't marked as parameters. The warnings are just that the first infile is usually has the name 'infile' for consistency with other EMBOSS applications. You can choose to ignore warnings for local applications. So, infile: infile [ parameter: "Y" knowntype: "sequence data" prompt: "Name of Sequence (in arbitrary format)" information: "Protein Sequence or Accession number input" ] is what acdvalid would prefer. HTH Alan > Hello, > > I try to build my own ACD file for one of our application but acdvalid > returns a strange error message: > > Warning: File tmpred.acd line 26: Information string for 'in' not > standard 'Sequence file' > Error: File tmpred.acd line 26: First input file 'in' is not a parameter > Warning: File tmpred.acd line 26: Infile qualifier 'in' is not 'infile' > or '*file'(should be 'infile') > > > Here is the problematic section: > section: input [ > information: "Input section" > type: "page" > ] > > infile: in [ > standard: "Y" > knowntype: "sequence data" > prompt: "Name of Sequence (in arbitrary format)" > information: "Protein Sequence or Accession number input" > ] > ... > > Do you know how to resolve this ? > (I use EMBOSS 5.0.0) > > Thanks > > > -- > S??bastien Moretti > SIB, Quartier Sorge - Genopode > CH-1015 Lausanne, Switzerland > Tel.: +41 (21) 692 4056/4221 > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From Sebastien.Moretti at unil.ch Fri Mar 14 15:56:03 2008 From: Sebastien.Moretti at unil.ch (Sebastien Moretti) Date: Fri, 14 Mar 2008 16:56:03 +0100 Subject: [EMBOSS] ACD syntax error for infile In-Reply-To: <59819.86.14.232.77.1205509121.squirrel@webmail.ebi.ac.uk> References: <47DA8A7D.2010005@unil.ch> <59819.86.14.232.77.1205509121.squirrel@webmail.ebi.ac.uk> Message-ID: <47DAA013.7010000@unil.ch> > The error message is, in this case, rather helpful. Just change > 'standard' to 'parameter'. The rationale for this is that the first > input file in an ACD file should usually be a 'parameter' to enable > people to just specify the filename (without qualifier switch) on the > command line. acdvalid will just give warnings for subsequent files that > aren't marked as parameters. > > The warnings are just that the first infile is usually has the > name 'infile' for consistency with other EMBOSS applications. > You can choose to ignore warnings for local applications. > > So, > > infile: infile [ > parameter: "Y" > knowntype: "sequence data" > prompt: "Name of Sequence (in arbitrary format)" > information: "Protein Sequence or Accession number input" > ] > > is what acdvalid would prefer. > > HTH > > Alan Hi Alan, Thanks, nevertheless, I cannot use 'parameter: "Y"' because my application requires both parameter-name and parameter-value: -in=your_file So, I will try to use the ACD file with the error. >> Hello, >> >> I try to build my own ACD file for one of our application but acdvalid >> returns a strange error message: >> >> Warning: File tmpred.acd line 26: Information string for 'in' not >> standard 'Sequence file' >> Error: File tmpred.acd line 26: First input file 'in' is not a parameter >> Warning: File tmpred.acd line 26: Infile qualifier 'in' is not 'infile' >> or '*file'(should be 'infile') >> >> >> Here is the problematic section: >> section: input [ >> information: "Input section" >> type: "page" >> ] >> >> infile: in [ >> standard: "Y" >> knowntype: "sequence data" >> prompt: "Name of Sequence (in arbitrary format)" >> information: "Protein Sequence or Accession number input" >> ] >> ... >> >> Do you know how to resolve this ? >> (I use EMBOSS 5.0.0) >> >> Thanks -- S?bastien Moretti SIB, Quartier Sorge - Genopode CH-1015 Lausanne, Switzerland Tel.: +41 (21) 692 4056/4221 From Sebastien.Moretti at unil.ch Fri Mar 14 15:56:40 2008 From: Sebastien.Moretti at unil.ch (Sebastien Moretti) Date: Fri, 14 Mar 2008 16:56:40 +0100 Subject: [EMBOSS] See ACD as command line Message-ID: <47DAA038.4060804@unil.ch> Hello, Is there a simple way to see our ACD files as command lines ? I would like to check the command line syntax without running the application. Thanks -- S?bastien Moretti From pmr at ebi.ac.uk Fri Mar 14 16:36:27 2008 From: pmr at ebi.ac.uk (Peter Rice) Date: Fri, 14 Mar 2008 16:36:27 +0000 Subject: [EMBOSS] ACD syntax error for infile In-Reply-To: <47DAA013.7010000@unil.ch> References: <47DA8A7D.2010005@unil.ch> <59819.86.14.232.77.1205509121.squirrel@webmail.ebi.ac.uk> <47DAA013.7010000@unil.ch> Message-ID: <47DAA98B.503@ebi.ac.uk> Sebastien Moretti wrote: > Thanks, > nevertheless, I cannot use 'parameter: "Y"' because my application > requires both parameter-name and parameter-value: > -in=your_file > > So, I will try to use the ACD file with the error. No problem. acdvalid is there to check consistency for the main EMBOSS and EMBASSY ACD files. The applications will run with no problem. Note: if you have the parameter definition, and the infile qualifier name, the -in=your_file syntax will still be valid on the command line :-) Peter From pmr at ebi.ac.uk Fri Mar 14 16:40:48 2008 From: pmr at ebi.ac.uk (Peter Rice) Date: Fri, 14 Mar 2008 16:40:48 +0000 Subject: [EMBOSS] See ACD as command line In-Reply-To: <47DAA038.4060804@unil.ch> References: <47DAA038.4060804@unil.ch> Message-ID: <47DAAA90.2060603@ebi.ac.uk> Hi Sabastian, Sebastien Moretti wrote: > Hello, > > Is there a simple way to see our ACD files as command lines ? > > I would like to check the command line syntax without running the > application. No problem. You do not even need to write the application. With the acd file written you just need: acdc appname to try running the application. It will read input and open output files and then stop. acdc appname -help will give you the help If you have the application written then appname -help will work too. If you need more we can help .... all we need to do it write something like "acdtable" and add a different control call to dump out a command line from the ACD processing. For example, we could show the shortest abbreviations of qualifier names. regards, Peter From staffa at niehs.nih.gov Mon Mar 17 22:44:33 2008 From: staffa at niehs.nih.gov (Staffa, Nick (NIH/NIEHS)) Date: Mon, 17 Mar 2008 18:44:33 -0400 Subject: [EMBOSS] Jemboss Alignment Editor Message-ID: what's up? Does anybody use Jemboss? Is it supposed to work as advertised? If I click on a file, even an GCG msf file, and do a right-click, open With/Jemboss Alignment Editor, the editor does not pop up. When I bring the JAL up from the Tools menu, and do a File/Open.... to get an msf file from the server or from the desktop, I don't see that anything has entered the JAL. What could be up, Doc? Jalview can open msf files that are local, but is not an option on "Open With...". From Marc.Logghe at ablynx.com Wed Mar 19 08:29:28 2008 From: Marc.Logghe at ablynx.com (Marc Logghe) Date: Wed, 19 Mar 2008 09:29:28 +0100 Subject: [EMBOSS] needle -nobrief Message-ID: <03C512635899144083CADB0EE222018901792167@alpaca.lan.ablynx.com> Hi all, I have checked the docs and googled around but I did not find an explanation for how the shortest_similarity or shortest_identity is calculated by needle (using the -nobrief option). For longest_identity it seems to be: (Identical residues x 100)/(Length of Alignment - Total Number of Gaps in Alignment) Thanks and regards, Marc From ajb at ebi.ac.uk Wed Mar 19 09:29:26 2008 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Wed, 19 Mar 2008 09:29:26 -0000 (GMT) Subject: [EMBOSS] needle -nobrief In-Reply-To: <03C512635899144083CADB0EE222018901792167@alpaca.lan.ablynx.com> References: <03C512635899144083CADB0EE222018901792167@alpaca.lan.ablynx.com> Message-ID: <47038.86.14.232.77.1205918966.squirrel@webmail.ebi.ac.uk> >From a quick look at the code: Longest identity: you're right i.e. (Identical residues x 100)/(Length of Alignment - Total Number of Gaps in Alignment) Shortest identity = number of identical residues * 100 / length of longest original sequence The similarity calculations are the same as the 'identical' ones except that the number of identical residues is replaced by the number of pairwise comparisons that have a positive score in the comparison matrix. HTH Alan > Hi all, > > I have checked the docs and googled around but I did not find an > explanation for how the shortest_similarity or shortest_identity is > calculated by needle (using the -nobrief option). > > For longest_identity it seems to be: > > (Identical residues x 100)/(Length of Alignment - Total Number of Gaps > in Alignment) > > Thanks and regards, > > Marc > > > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From Marc.Logghe at ablynx.com Wed Mar 19 10:08:07 2008 From: Marc.Logghe at ablynx.com (Marc Logghe) Date: Wed, 19 Mar 2008 11:08:07 +0100 Subject: [EMBOSS] needle -nobrief In-Reply-To: <47038.86.14.232.77.1205918966.squirrel@webmail.ebi.ac.uk> References: <03C512635899144083CADB0EE222018901792167@alpaca.lan.ablynx.com> <47038.86.14.232.77.1205918966.squirrel@webmail.ebi.ac.uk> Message-ID: <03C512635899144083CADB0EE22201890179221D@alpaca.lan.ablynx.com> Great, thanks ! > -----Original Message----- > From: ajb at ebi.ac.uk [mailto:ajb at ebi.ac.uk] > Sent: Wednesday, March 19, 2008 10:29 AM > To: Marc Logghe > Cc: emboss at lists.open-bio.org > Subject: Re: [EMBOSS] needle -nobrief > > > From a quick look at the code: > > > Longest identity: you're right i.e. > (Identical residues x 100)/(Length of Alignment - Total Number of Gaps > in Alignment) > > > > Shortest identity = number of identical residues * 100 / > length of longest original sequence > > > The similarity calculations are the same as the 'identical' ones > except that the number of identical residues is replaced by the > number of pairwise comparisons that have a positive score in > the comparison matrix. > > HTH > > Alan > > > > > > Hi all, > > > > I have checked the docs and googled around but I did not find an > > explanation for how the shortest_similarity or shortest_identity is > > calculated by needle (using the -nobrief option). > > > > For longest_identity it seems to be: > > > > (Identical residues x 100)/(Length of Alignment - Total Number of Gaps > > in Alignment) > > > > Thanks and regards, > > > > Marc > > > > > > > > > > _______________________________________________ > > EMBOSS mailing list > > EMBOSS at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/emboss > > > From gbottu at vub.ac.be Wed Mar 19 10:22:14 2008 From: gbottu at vub.ac.be (Guy Bottu) Date: Wed, 19 Mar 2008 11:22:14 +0100 Subject: [EMBOSS] needle -nobrief In-Reply-To: <03C512635899144083CADB0EE222018901792167@alpaca.lan.ablynx.com> References: <03C512635899144083CADB0EE222018901792167@alpaca.lan.ablynx.com> Message-ID: <47E0E956.7070308@vub.ac.be> Dear Marc, I indeed do not see the explanation in the manual, but I did some testing and I understand that : - Identity and Similarity are computed by dividing by the total length of the alignment - Longest_Identity and Longest_Similarity are computed by dividing by the number of aligned positions (= total length of the alignment - number of indels) - Shortest_Identity and Shortest_Similarity are computed by dividing by the length of the longest sequence Regards, Guy Bottu, Belgian EMBnet Node From staffa at niehs.nih.gov Wed Mar 19 17:20:19 2008 From: staffa at niehs.nih.gov (Staffa, Nick (NIH/NIEHS)) Date: Wed, 19 Mar 2008 13:20:19 -0400 Subject: [EMBOSS] [Jemboss] needle Jemboss on MacIntosh In-Reply-To: <47E0E956.7070308@vub.ac.be> Message-ID: Running Jemboss on a Mac. I have a folder of GCG sequences, one of which I have included. When I open these files in textedit, they are complete. However when double clicked in the file manager, they look like fasta files with no sequence information. Likewise when input to a program like needle. It doesn't seem to matter what is done with Input Sequence Options. What's Up, Doc? Nick Staffa Telephone: 919-316-4569 (NIEHS: 6-4569) Scientific Computing Support Group NIEHS Information Technology Support Services Contract (Science Task Monitor: Roy W. Reter (reter at niehs.nih.gov) National Institute of Environmental Health Sciences National Institutes of Health Research Triangle Park, North Carolina -------------- next part -------------- An embedded and charset-unspecified text was scrubbed... Name: hspgk2g.seq URL: From ajb at ebi.ac.uk Wed Mar 19 20:16:43 2008 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Wed, 19 Mar 2008 20:16:43 -0000 (GMT) Subject: [EMBOSS] [Jemboss] needle Jemboss on MacIntosh In-Reply-To: References: <47E0E956.7070308@vub.ac.be> Message-ID: <56434.86.14.232.77.1205957803.squirrel@webmail.ebi.ac.uk> Is this a case of running a Jemboss client on the Mac but the Jemboss server on a UNIX machine? If that is the case then the problem is likely to be that your input files have lines terminated with '\r' whereas the server will be expecting them to terminate with '\n'. EMBOSS does cater for '\r'-terminated files but only if EMBOSS itself is compiled under MacOSX PPC. The first thing to try would be for you to convert the files i.e. under UNIX you could use: tr '\r' '\n' < macfile > unixfile to do it. Then try giving the UNIX-formatted file to the server. We could arrange for EMBOSS to always detect whether UNIX (LF), Mac (CR) or M$ (CRLF) user files are given but it'd be a performance hit. One way would be to provide it as an EMBOSS configuration option. We'll discuss it anyway. HTH Alan > > Running Jemboss on a Mac. > I have a folder of GCG sequences, one of which I have included. > When I open these files in textedit, they are complete. > However when double clicked in the file manager, they look like fasta > files > with no sequence information. Likewise when input to a program like > needle. > It doesn't seem to matter what is done with Input Sequence Options. > > What's Up, Doc? > > > > Nick Staffa > Telephone: 919-316-4569 (NIEHS: 6-4569) > Scientific Computing Support Group > NIEHS Information Technology Support Services Contract > (Science Task Monitor: Roy W. Reter (reter at niehs.nih.gov) > National Institute of Environmental Health Sciences > National Institutes of Health > Research Triangle Park, North Carolina > > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From robin at hms.harvard.edu Thu Mar 20 18:57:43 2008 From: robin at hms.harvard.edu (Robin Colgrove) Date: Thu, 20 Mar 2008 14:57:43 -0400 Subject: [EMBOSS] Run Date error in fuzzpro and patmatdb? Message-ID: <48CA384F-277E-4E2D-B92A-0980B70FFF45@hms.harvard.edu> Hi all. I haven't posted here for a long time so apologies if I do this the wrong way. I am only an occasional EMBOSS user (v 2.10.0, OSX, command line) but I was just running fuzzpro and patmatdb and got a weird date: # Program: fuzzpro # Rundate: Sun Mar 20 2008 14:46:12 # Report_format: seqtable # Report_file: hsv-1icp8.fuzzpro Now, I am pretty sure it is not Sunday. Same error occurs in patmatdb. Is this a known bug? program seem to work fine otherwise. thanks robin colgrove micro dept. harvard med From ajb at ebi.ac.uk Thu Mar 20 23:06:10 2008 From: ajb at ebi.ac.uk (ajb at ebi.ac.uk) Date: Thu, 20 Mar 2008 23:06:10 -0000 (GMT) Subject: [EMBOSS] Run Date error in fuzzpro and patmatdb? In-Reply-To: <48CA384F-277E-4E2D-B92A-0980B70FFF45@hms.harvard.edu> References: <48CA384F-277E-4E2D-B92A-0980B70FFF45@hms.harvard.edu> Message-ID: <59884.86.14.232.77.1206054370.squirrel@webmail.ebi.ac.uk> Hello Robin, I cannot reproduce it on my non-MacOSX UNIXen here with 2.10.0 (or indeed 5.0.0 which you might consider trying - I can't see anything in the source code logs that mention the effect you're seeing but it's worth a shot). I'd be glad of further details (i.e. MacOSX version, architecture [ppc or x86], compiler version, Xcode tools version). Bugs in the implementation of the system strftime() function on various operating systems are not uncommon. I also cannot recall anyone ever reporting such a bug. If anyone else has ever seen this or solved it then please send us details (emboss-bug at emboss.open-bio.org). Thanks Alan > > Hi all. > I haven't posted here for a long time so apologies if I do this the > wrong way. > I am only an occasional EMBOSS user (v 2.10.0, OSX, command line) but > I was just running fuzzpro and patmatdb and got a weird date: > > # Program: fuzzpro > # Rundate: Sun Mar 20 2008 14:46:12 > # Report_format: seqtable > # Report_file: hsv-1icp8.fuzzpro > > > Now, I am pretty sure it is not Sunday. > Same error occurs in patmatdb. > > Is this a known bug? > > program seem to work fine otherwise. > > thanks > > robin colgrove > micro dept. > harvard med > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss > From car44 at cam.ac.uk Tue Mar 25 20:36:11 2008 From: car44 at cam.ac.uk (C.A. Russell) Date: 25 Mar 2008 20:36:11 +0000 Subject: [EMBOSS] fdrawgram, no prompting Message-ID: I'm trying to automate the plotting of a large number of trees. I'm using the following command to plot trees fdrawgram -intreefile infile -plotfile outfile.ps -previewer n -plotter l -auto Everything is good except that I can't figure out how to stop fdrawgram from prompting me with "Is the tree ready to be plotted? Type Y or N:" I thought that -auto should make the assumption that indeed the tree is ready to be plotted but I still get prompted. Can anyone tell what arguments to pass to fdrawgram to make it not prompt me? If it makes a difference I'm running OS X 10.4.9 Many thanks Colin From uludag at ebi.ac.uk Wed Mar 26 11:40:18 2008 From: uludag at ebi.ac.uk (Mahmut Uludag) Date: Wed, 26 Mar 2008 11:40:18 +0000 Subject: [EMBOSS] fdrawgram, no prompting In-Reply-To: References: Message-ID: <1206531618.10249.20.camel@emboss2.ebi.ac.uk> > I'm trying to automate the plotting of a large number of trees. I'm using > the following command to plot trees > > fdrawgram -intreefile infile -plotfile outfile.ps -previewer n -plotter l > -auto > > Everything is good except that I can't figure out how to stop fdrawgram > from prompting me with > > "Is the tree ready to be plotted? Type Y or N:" > > I thought that -auto should make the assumption that indeed the tree is > ready to be plotted but I still get prompted. Can anyone tell what > arguments to pass to fdrawgram to make it not prompt me? If you don't present the previewer option on the command line then emboss doesn't ask the above question. (fdrawgram documentation suggests that when previewer is 'n' (means 'will not be previewed') the above question should not be asked. I'm sure you will get a full reply to your question from Peter.) Regards, Mahmut From schueffi at mpi-sb.mpg.de Fri Mar 28 10:26:17 2008 From: schueffi at mpi-sb.mpg.de (=?ISO-8859-1?Q?Peter_Sch=FCffler?=) Date: Fri, 28 Mar 2008 11:26:17 +0100 Subject: [EMBOSS] HELP!! ePrimer3 service down? Message-ID: <47ECC7C9.504@mpi-sb.mpg.de> Hallo, I'm using the eprimer3 service from EMBOSS in my Java source code. This is a great service!!! :-) But for a while, the service doesn't work (but has worked before!). Here my source code and the failure message from Java. Do I something wrong, or does server something wrong? THANK YOU!!! Peter public static void main(String[] args) { String seq = "TCTAGAAAAATTTTTTAAAAAATTAGGCCGCTCGAGCGAGAGTGCAGTGGCTCACGCCTGTAATCCAACA" + "CTTCAGGAGGCTGAAGAGGGTGGATCACCTGAGGTCAGGAGTTCCAGACCAGCCTGGCCAACATGGTGAA"; try { // CONSTRUCT THE SERVICE AnalysisServiceService service = new AnalysisServiceServiceLocator(); Nucleic_PrimersEprimer3SoapBindingStub primer = (Nucleic_PrimersEprimer3SoapBindingStub) service.getNucleic_PrimersEprimer3(); // SET UP THE PARAMETERS HashMap params = new HashMap(); params.put("sequence_direct_data", seq); params.put("task", 1); params.put("numreturn", 100); // RUN ePRIMER3 HashMap result = primer.runAndWaitFor(params); String output = (String) result.get("outfile"); System.out.println(output); } catch (RemoteException ex) { Logger.getLogger(Eprimer3.class.getName()).log(Level.SEVERE, null, ex); } catch (Exception ex) { Logger.getLogger(Eprimer3.class.getName()).log(Level.SEVERE, null, ex); } } HERE THE MESSAGE:: Mar 28, 2008 11:24:07 AM mm_filters.Eprimer3 main SEVERE: null AxisFault faultCode: {http://schemas.xmlsoap.org/soap/envelope/}Server.userException faultString: java.lang.IllegalArgumentException: Conversion to SoaplabMap failed: Found an unsupported type 'java.lang.Integer'. faultActor: null faultDetail: hostname: web57-node1.ebi.ac.uk java.lang.IllegalArgumentException: Conversion to SoaplabMap failed: Found an unsupported type 'java.lang.Integer'. at org.apache.axis.message.SOAPFaultBuilder.endElement(SOAPFaultBuilder.java:135) at org.apache.axis.encoding.DeserializationContextImpl.endElement(DeserializationContextImpl.java:942) at org.apache.xerces.parsers.AbstractSAXParser.endElement(Unknown Source) at org.apache.xerces.impl.XMLNSDocumentScannerImpl.scanEndElement(Unknown Source) at org.apache.xerces.impl.XMLDocumentFragmentScannerImpl$FragmentContentDispatcher.dispatch(Unknown Source) at org.apache.xerces.impl.XMLDocumentFragmentScannerImpl.scanDocument(Unknown Source) at org.apache.xerces.parsers.DTDConfiguration.parse(Unknown Source) at org.apache.xerces.parsers.DTDConfiguration.parse(Unknown Source) at org.apache.xerces.parsers.XMLParser.parse(Unknown Source) at org.apache.xerces.parsers.AbstractSAXParser.parse(Unknown Source) at javax.xml.parsers.SAXParser.parse(SAXParser.java:375) at org.apache.axis.encoding.DeserializationContextImpl.parse(DeserializationContextImpl.java:232) at org.apache.axis.SOAPPart.getAsSOAPEnvelope(SOAPPart.java:546) at org.apache.axis.Message.getSOAPEnvelope(Message.java:377) at org.apache.axis.client.Call.invokeEngine(Call.java:2132) at org.apache.axis.client.Call.invoke(Call.java:2102) at org.apache.axis.client.Call.invoke(Call.java:1851) at org.apache.axis.client.Call.invoke(Call.java:1777) at org.apache.axis.client.Call.invoke(Call.java:1315) at uk.ac.ebi.www.Nucleic_PrimersEprimer3SoapBindingStub.runAndWaitFor(Nucleic_PrimersEprimer3SoapBindingStub.java:435) at mm_filters.Eprimer3.main(Eprimer3.java:162) From uludag at ebi.ac.uk Fri Mar 28 11:17:08 2008 From: uludag at ebi.ac.uk (Mahmut Uludag) Date: Fri, 28 Mar 2008 11:17:08 +0000 Subject: [EMBOSS] HELP!! ePrimer3 service down? In-Reply-To: <47ECC7C9.504@mpi-sb.mpg.de> References: <47ECC7C9.504@mpi-sb.mpg.de> Message-ID: <1206703028.12782.18.camel@emboss2.ebi.ac.uk> > But for a while, the service doesn't work (but has worked before!). should be related to changes I made recently :( will check it and return back soon! Mahmut From pmr at ebi.ac.uk Fri Mar 28 11:53:33 2008 From: pmr at ebi.ac.uk (Peter Rice) Date: Fri, 28 Mar 2008 11:53:33 +0000 Subject: [EMBOSS] fdrawgram, no prompting In-Reply-To: <1206531618.10249.20.camel@emboss2.ebi.ac.uk> References: <1206531618.10249.20.camel@emboss2.ebi.ac.uk> Message-ID: <47ECDC3D.5010402@ebi.ac.uk> Mahmut Uludag wrote: > (fdrawgram documentation suggests that when previewer is 'n' (means > 'will not be previewed') the above question should not be asked. I'm > sure you will get a full reply to your question from Peter.) Just back from vacation without email - very relaxing. There is a bug caused by a clash between the EMBOSS interface turning off the preview and some phylip code turning it on again. It will be fixed in the next release. If you are desperate to turn off the message I can send a couple of simple updates to the source code to fix it. > If you don't present the previewer option on the command line then > emboss doesn't ask the above question. This is another bug which fails to preview in X11 ... phylip defines Xwindows in a different way to EMBOSS. With a quick fix I can make the X previewer work, but there are also problems with the fonts. It will be fixed for the next release, which will also include an upgrade to use the latest phylip version. Hope that helps, Peter From uludag at ebi.ac.uk Fri Mar 28 12:00:07 2008 From: uludag at ebi.ac.uk (Mahmut Uludag) Date: Fri, 28 Mar 2008 12:00:07 +0000 Subject: [EMBOSS] HELP!! ePrimer3 service down? In-Reply-To: <47ECC7C9.504@mpi-sb.mpg.de> References: <47ECC7C9.504@mpi-sb.mpg.de> Message-ID: <1206705608.12782.27.camel@emboss2.ebi.ac.uk> Hi Peter, > But for a while, the service doesn't work (but has worked before!). Can you please try running the service again? We recently moved the server to Soaplab-2 where we have some changes in the generic input maps. I have checked in a fix for this problem and updated the server and will later discuss this issue with Martin for a proper fix that might go into the soaplab-2 code base. Regards, Mahmut > Here my source code and the failure message from Java. > > Do I something wrong, or does server something wrong? > > THANK YOU!!! > > Peter > > > public static void main(String[] args) { > String seq = > "TCTAGAAAAATTTTTTAAAAAATTAGGCCGCTCGAGCGAGAGTGCAGTGGCTCACGCCTGTAATCCAACA" + > > "CTTCAGGAGGCTGAAGAGGGTGGATCACCTGAGGTCAGGAGTTCCAGACCAGCCTGGCCAACATGGTGAA"; > > try { > // CONSTRUCT THE SERVICE > > AnalysisServiceService service = new > AnalysisServiceServiceLocator(); > Nucleic_PrimersEprimer3SoapBindingStub primer = > (Nucleic_PrimersEprimer3SoapBindingStub) > service.getNucleic_PrimersEprimer3(); > > // SET UP THE PARAMETERS > HashMap params = new HashMap(); > params.put("sequence_direct_data", seq); > params.put("task", 1); > params.put("numreturn", 100); > > // RUN ePRIMER3 > HashMap result = primer.runAndWaitFor(params); > > String output = (String) result.get("outfile"); > System.out.println(output); > > } catch (RemoteException ex) { > Logger.getLogger(Eprimer3.class.getName()).log(Level.SEVERE, > null, ex); > } catch (Exception ex) { > Logger.getLogger(Eprimer3.class.getName()).log(Level.SEVERE, > null, ex); > } > } > > > > HERE THE MESSAGE:: > > Mar 28, 2008 11:24:07 AM mm_filters.Eprimer3 main > SEVERE: null > AxisFault > faultCode: {http://schemas.xmlsoap.org/soap/envelope/}Server.userException > faultString: java.lang.IllegalArgumentException: Conversion to > SoaplabMap failed: Found an unsupported type 'java.lang.Integer'. > faultActor: null > faultDetail: > hostname: web57-node1.ebi.ac.uk > > java.lang.IllegalArgumentException: Conversion to SoaplabMap failed: > Found an unsupported type 'java.lang.Integer'. > at > org.apache.axis.message.SOAPFaultBuilder.endElement(SOAPFaultBuilder.java:135) > at > org.apache.axis.encoding.DeserializationContextImpl.endElement(DeserializationContextImpl.java:942) > at > org.apache.xerces.parsers.AbstractSAXParser.endElement(Unknown Source) > at > org.apache.xerces.impl.XMLNSDocumentScannerImpl.scanEndElement(Unknown > Source) > at > org.apache.xerces.impl.XMLDocumentFragmentScannerImpl$FragmentContentDispatcher.dispatch(Unknown > Source) > at > org.apache.xerces.impl.XMLDocumentFragmentScannerImpl.scanDocument(Unknown > Source) > at org.apache.xerces.parsers.DTDConfiguration.parse(Unknown Source) > at org.apache.xerces.parsers.DTDConfiguration.parse(Unknown Source) > at org.apache.xerces.parsers.XMLParser.parse(Unknown Source) > at org.apache.xerces.parsers.AbstractSAXParser.parse(Unknown Source) > at javax.xml.parsers.SAXParser.parse(SAXParser.java:375) > at > org.apache.axis.encoding.DeserializationContextImpl.parse(DeserializationContextImpl.java:232) > at org.apache.axis.SOAPPart.getAsSOAPEnvelope(SOAPPart.java:546) > at org.apache.axis.Message.getSOAPEnvelope(Message.java:377) > at org.apache.axis.client.Call.invokeEngine(Call.java:2132) > at org.apache.axis.client.Call.invoke(Call.java:2102) > at org.apache.axis.client.Call.invoke(Call.java:1851) > at org.apache.axis.client.Call.invoke(Call.java:1777) > at org.apache.axis.client.Call.invoke(Call.java:1315) > at > uk.ac.ebi.www.Nucleic_PrimersEprimer3SoapBindingStub.runAndWaitFor(Nucleic_PrimersEprimer3SoapBindingStub.java:435) > at mm_filters.Eprimer3.main(Eprimer3.java:162) > > > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss From schueffi at mpi-sb.mpg.de Fri Mar 28 12:10:51 2008 From: schueffi at mpi-sb.mpg.de (=?ISO-8859-1?Q?Peter_Sch=FCffler?=) Date: Fri, 28 Mar 2008 13:10:51 +0100 Subject: [EMBOSS] HELP!! ePrimer3 service down? In-Reply-To: <1206705608.12782.27.camel@emboss2.ebi.ac.uk> References: <47ECC7C9.504@mpi-sb.mpg.de> <1206705608.12782.27.camel@emboss2.ebi.ac.uk> Message-ID: <47ECE04B.3040409@mpi-sb.mpg.de> Seems to work. No Error message, and normal output. THANK YOU!!! Mahmut Uludag wrote: > Hi Peter, > > >> But for a while, the service doesn't work (but has worked before!). >> > > Can you please try running the service again? We recently moved the > server to Soaplab-2 where we have some changes in the generic input > maps. I have checked in a fix for this problem and updated the server > and will later discuss this issue with Martin for a proper fix that > might go into the soaplab-2 code base. > > Regards, > Mahmut > > > >> Here my source code and the failure message from Java. >> >> Do I something wrong, or does server something wrong? >> >> THANK YOU!!! >> >> Peter >> >> >> public static void main(String[] args) { >> String seq = >> "TCTAGAAAAATTTTTTAAAAAATTAGGCCGCTCGAGCGAGAGTGCAGTGGCTCACGCCTGTAATCCAACA" + >> >> "CTTCAGGAGGCTGAAGAGGGTGGATCACCTGAGGTCAGGAGTTCCAGACCAGCCTGGCCAACATGGTGAA"; >> >> try { >> // CONSTRUCT THE SERVICE >> >> AnalysisServiceService service = new >> AnalysisServiceServiceLocator(); >> Nucleic_PrimersEprimer3SoapBindingStub primer = >> (Nucleic_PrimersEprimer3SoapBindingStub) >> service.getNucleic_PrimersEprimer3(); >> >> // SET UP THE PARAMETERS >> HashMap params = new HashMap(); >> params.put("sequence_direct_data", seq); >> params.put("task", 1); >> params.put("numreturn", 100); >> >> // RUN ePRIMER3 >> HashMap result = primer.runAndWaitFor(params); >> >> String output = (String) result.get("outfile"); >> System.out.println(output); >> >> } catch (RemoteException ex) { >> Logger.getLogger(Eprimer3.class.getName()).log(Level.SEVERE, >> null, ex); >> } catch (Exception ex) { >> Logger.getLogger(Eprimer3.class.getName()).log(Level.SEVERE, >> null, ex); >> } >> } >> >> >> >> HERE THE MESSAGE:: >> >> Mar 28, 2008 11:24:07 AM mm_filters.Eprimer3 main >> SEVERE: null >> AxisFault >> faultCode: {http://schemas.xmlsoap.org/soap/envelope/}Server.userException >> faultString: java.lang.IllegalArgumentException: Conversion to >> SoaplabMap failed: Found an unsupported type 'java.lang.Integer'. >> faultActor: null >> faultDetail: >> hostname: web57-node1.ebi.ac.uk >> >> java.lang.IllegalArgumentException: Conversion to SoaplabMap failed: >> Found an unsupported type 'java.lang.Integer'. >> at >> org.apache.axis.message.SOAPFaultBuilder.endElement(SOAPFaultBuilder.java:135) >> at >> org.apache.axis.encoding.DeserializationContextImpl.endElement(DeserializationContextImpl.java:942) >> at >> org.apache.xerces.parsers.AbstractSAXParser.endElement(Unknown Source) >> at >> org.apache.xerces.impl.XMLNSDocumentScannerImpl.scanEndElement(Unknown >> Source) >> at >> org.apache.xerces.impl.XMLDocumentFragmentScannerImpl$FragmentContentDispatcher.dispatch(Unknown >> Source) >> at >> org.apache.xerces.impl.XMLDocumentFragmentScannerImpl.scanDocument(Unknown >> Source) >> at org.apache.xerces.parsers.DTDConfiguration.parse(Unknown Source) >> at org.apache.xerces.parsers.DTDConfiguration.parse(Unknown Source) >> at org.apache.xerces.parsers.XMLParser.parse(Unknown Source) >> at org.apache.xerces.parsers.AbstractSAXParser.parse(Unknown Source) >> at javax.xml.parsers.SAXParser.parse(SAXParser.java:375) >> at >> org.apache.axis.encoding.DeserializationContextImpl.parse(DeserializationContextImpl.java:232) >> at org.apache.axis.SOAPPart.getAsSOAPEnvelope(SOAPPart.java:546) >> at org.apache.axis.Message.getSOAPEnvelope(Message.java:377) >> at org.apache.axis.client.Call.invokeEngine(Call.java:2132) >> at org.apache.axis.client.Call.invoke(Call.java:2102) >> at org.apache.axis.client.Call.invoke(Call.java:1851) >> at org.apache.axis.client.Call.invoke(Call.java:1777) >> at org.apache.axis.client.Call.invoke(Call.java:1315) >> at >> uk.ac.ebi.www.Nucleic_PrimersEprimer3SoapBindingStub.runAndWaitFor(Nucleic_PrimersEprimer3SoapBindingStub.java:435) >> at mm_filters.Eprimer3.main(Eprimer3.java:162) >> >> >> _______________________________________________ >> EMBOSS mailing list >> EMBOSS at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/emboss >> > > From Sebastien.Moretti at unil.ch Fri Mar 28 12:08:11 2008 From: Sebastien.Moretti at unil.ch (Sebastien Moretti) Date: Fri, 28 Mar 2008 13:08:11 +0100 Subject: [EMBOSS] knowntypes Message-ID: <47ECDFAB.5020902@unil.ch> Hi, Are there 'official' knowntypes for stdout, stderr (outfile) ? And the equivalent of 'dna fasta' for protein infile ? Thanks -- S?bastien Moretti SIB, Quartier Sorge - Genopode CH-1015 Lausanne, Switzerland Tel.: +41 (21) 692 4056/4221 From schueffi at mpi-sb.mpg.de Fri Mar 28 13:17:23 2008 From: schueffi at mpi-sb.mpg.de (=?ISO-8859-1?Q?Peter_Sch=FCffler?=) Date: Fri, 28 Mar 2008 14:17:23 +0100 Subject: [EMBOSS] HELP!! ePrimer3 service down? In-Reply-To: <47ECE04B.3040409@mpi-sb.mpg.de> References: <47ECC7C9.504@mpi-sb.mpg.de> <1206705608.12782.27.camel@emboss2.ebi.ac.uk> <47ECE04B.3040409@mpi-sb.mpg.de> Message-ID: <47ECEFE3.3030203@mpi-sb.mpg.de> Well, it works, but there is a difference: I use the params mintm and maxtm for eprimer3. These values must now be integers (formaly, they were doubles - now, when they are doubles, an Error arises without successful primer findings). Don't now if this concerns also other params... AxisFault faultCode: {http://schemas.xmlsoap.org/soap/envelope/}Server.userException faultString: java.lang.IllegalArgumentException: Conversion to SoaplabMap failed: Found an unsupported type 'java.lang.Double'. faultActor: null faultDetail: hostname: web57-node1.ebi.ac.uk java.lang.IllegalArgumentException: Conversion to SoaplabMap failed: Found an unsupported type 'java.lang.Double'. at org.apache.axis.message.SOAPFaultBuilder.endElement(SOAPFaultBuilder.java:135) at org.apache.axis.encoding.DeserializationContextImpl.endElement(DeserializationContextImpl.java:942) at org.apache.xerces.parsers.AbstractSAXParser.endElement(Unknown Source) at org.apache.xerces.impl.XMLNSDocumentScannerImpl.scanEndElement(Unknown Source) at org.apache.xerces.impl.XMLDocumentFragmentScannerImpl$FragmentContentDispatcher.dispatch(Unknown Source) at org.apache.xerces.impl.XMLDocumentFragmentScannerImpl.scanDocument(Unknown Source) at org.apache.xerces.parsers.DTDConfiguration.parse(Unknown Source) at org.apache.xerces.parsers.DTDConfiguration.parse(Unknown Source) at org.apache.xerces.parsers.XMLParser.parse(Unknown Source) at org.apache.xerces.parsers.AbstractSAXParser.parse(Unknown Source) at javax.xml.parsers.SAXParser.parse(SAXParser.java:375) Peter Sch?ffler wrote: > Seems to work. No Error message, and normal output. > > THANK YOU!!! > > > > > Mahmut Uludag wrote: >> Hi Peter, >> >> >>> But for a while, the service doesn't work (but has worked before!). >>> >> >> Can you please try running the service again? We recently moved the >> server to Soaplab-2 where we have some changes in the generic input >> maps. I have checked in a fix for this problem and updated the server >> and will later discuss this issue with Martin for a proper fix that >> might go into the soaplab-2 code base. >> >> Regards, >> Mahmut >> >> >> >>> Here my source code and the failure message from Java. >>> >>> Do I something wrong, or does server something wrong? >>> >>> THANK YOU!!! >>> >>> Peter >>> >>> >>> public static void main(String[] args) { >>> String seq = >>> "TCTAGAAAAATTTTTTAAAAAATTAGGCCGCTCGAGCGAGAGTGCAGTGGCTCACGCCTGTAATCCAACA" >>> + >>> >>> "CTTCAGGAGGCTGAAGAGGGTGGATCACCTGAGGTCAGGAGTTCCAGACCAGCCTGGCCAACATGGTGAA"; >>> >>> >>> try { >>> // CONSTRUCT THE SERVICE >>> >>> AnalysisServiceService service = new >>> AnalysisServiceServiceLocator(); >>> Nucleic_PrimersEprimer3SoapBindingStub primer = >>> (Nucleic_PrimersEprimer3SoapBindingStub) >>> service.getNucleic_PrimersEprimer3(); >>> // SET UP THE PARAMETERS >>> HashMap params = new HashMap(); >>> params.put("sequence_direct_data", seq); >>> params.put("task", 1); >>> params.put("numreturn", 100); >>> >>> // RUN ePRIMER3 >>> HashMap result = primer.runAndWaitFor(params); >>> >>> String output = (String) result.get("outfile"); >>> System.out.println(output); >>> >>> } catch (RemoteException ex) { >>> >>> Logger.getLogger(Eprimer3.class.getName()).log(Level.SEVERE, null, ex); >>> } catch (Exception ex) { >>> >>> Logger.getLogger(Eprimer3.class.getName()).log(Level.SEVERE, null, ex); >>> } >>> } >>> >>> >>> >>> HERE THE MESSAGE:: >>> >>> Mar 28, 2008 11:24:07 AM mm_filters.Eprimer3 main >>> SEVERE: null >>> AxisFault >>> faultCode: >>> {http://schemas.xmlsoap.org/soap/envelope/}Server.userException >>> faultString: java.lang.IllegalArgumentException: Conversion to >>> SoaplabMap failed: Found an unsupported type 'java.lang.Integer'. >>> faultActor: null >>> faultDetail: >>> hostname: web57-node1.ebi.ac.uk >>> >>> java.lang.IllegalArgumentException: Conversion to SoaplabMap failed: >>> Found an unsupported type 'java.lang.Integer'. >>> at >>> org.apache.axis.message.SOAPFaultBuilder.endElement(SOAPFaultBuilder.java:135) >>> >>> at >>> org.apache.axis.encoding.DeserializationContextImpl.endElement(DeserializationContextImpl.java:942) >>> >>> at >>> org.apache.xerces.parsers.AbstractSAXParser.endElement(Unknown Source) >>> at >>> org.apache.xerces.impl.XMLNSDocumentScannerImpl.scanEndElement(Unknown >>> Source) >>> at >>> org.apache.xerces.impl.XMLDocumentFragmentScannerImpl$FragmentContentDispatcher.dispatch(Unknown >>> Source) >>> at >>> org.apache.xerces.impl.XMLDocumentFragmentScannerImpl.scanDocument(Unknown >>> Source) >>> at org.apache.xerces.parsers.DTDConfiguration.parse(Unknown >>> Source) >>> at org.apache.xerces.parsers.DTDConfiguration.parse(Unknown >>> Source) >>> at org.apache.xerces.parsers.XMLParser.parse(Unknown Source) >>> at org.apache.xerces.parsers.AbstractSAXParser.parse(Unknown >>> Source) >>> at javax.xml.parsers.SAXParser.parse(SAXParser.java:375) >>> at >>> org.apache.axis.encoding.DeserializationContextImpl.parse(DeserializationContextImpl.java:232) >>> >>> at >>> org.apache.axis.SOAPPart.getAsSOAPEnvelope(SOAPPart.java:546) >>> at org.apache.axis.Message.getSOAPEnvelope(Message.java:377) >>> at org.apache.axis.client.Call.invokeEngine(Call.java:2132) >>> at org.apache.axis.client.Call.invoke(Call.java:2102) >>> at org.apache.axis.client.Call.invoke(Call.java:1851) >>> at org.apache.axis.client.Call.invoke(Call.java:1777) >>> at org.apache.axis.client.Call.invoke(Call.java:1315) >>> at >>> uk.ac.ebi.www.Nucleic_PrimersEprimer3SoapBindingStub.runAndWaitFor(Nucleic_PrimersEprimer3SoapBindingStub.java:435) >>> >>> at mm_filters.Eprimer3.main(Eprimer3.java:162) >>> >>> >>> _______________________________________________ >>> EMBOSS mailing list >>> EMBOSS at lists.open-bio.org >>> http://lists.open-bio.org/mailman/listinfo/emboss >>> >> >> > _______________________________________________ > EMBOSS mailing list > EMBOSS at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss From pmr at ebi.ac.uk Fri Mar 28 13:30:44 2008 From: pmr at ebi.ac.uk (Peter Rice) Date: Fri, 28 Mar 2008 13:30:44 +0000 Subject: [EMBOSS] knowntypes In-Reply-To: <47ECDFAB.5020902@unil.ch> References: <47ECDFAB.5020902@unil.ch> Message-ID: <47ECF304.2020707@ebi.ac.uk> Sebastien Moretti wrote: > Are there 'official' knowntypes for stdout, stderr (outfile) ? And > the equivalent of 'dna fasta' for protein infile ? There are official knowntypes for files ... see the knowntypes.standard file in the ACD directory. These are the knowntypes we use in the ACD files. We welcome any suggestions for new types or changes to the existing types. The knowntypes are only used for validation (in acdvalid). We limit the types to try to reuse the same names for matching input and output files in different applications. We will add a "protein fasta" and a "sequence fasta" to the standards file. There is no problem with adding new knowntypes for your own applications, but we like to know which ones are found to be useful so we can make them official EMBOSS standard types too. regards, Peter Rice From uludag at ebi.ac.uk Fri Mar 28 13:44:39 2008 From: uludag at ebi.ac.uk (Mahmut Uludag) Date: Fri, 28 Mar 2008 13:44:39 +0000 Subject: [EMBOSS] HELP!! ePrimer3 service down? In-Reply-To: <47ECEFE3.3030203@mpi-sb.mpg.de> References: <47ECC7C9.504@mpi-sb.mpg.de> <1206705608.12782.27.camel@emboss2.ebi.ac.uk> <47ECE04B.3040409@mpi-sb.mpg.de> <47ECEFE3.3030203@mpi-sb.mpg.de> Message-ID: <1206711879.12782.37.camel@emboss2.ebi.ac.uk> > Well, it works, but there is a difference: > > I use the params mintm and maxtm for eprimer3. These values must now be > integers (formaly, they were doubles - now, when they are doubles, an > Error arises without successful primer findings). I have extended the fix for the type double as well and updated the server. I didn't do it straight away because didn't have time yet to discuss this with Martin. As you pointed we might have problems with other data types as well. Until we have a fix you can use String representation of the values in the input map rather than the actual data types. Regards, Mahmut From Sebastien.Moretti at unil.ch Fri Mar 28 13:51:07 2008 From: Sebastien.Moretti at unil.ch (Sebastien Moretti) Date: Fri, 28 Mar 2008 14:51:07 +0100 Subject: [EMBOSS] knowntypes In-Reply-To: <47ECF304.2020707@ebi.ac.uk> References: <47ECDFAB.5020902@unil.ch> <47ECF304.2020707@ebi.ac.uk> Message-ID: <47ECF7CB.9090305@unil.ch> >> Are there 'official' knowntypes for stdout, stderr (outfile) ? And >> the equivalent of 'dna fasta' for protein infile ? > > There are official knowntypes for files ... see the knowntypes.standard > file in the ACD directory. > > These are the knowntypes we use in the ACD files. We welcome any > suggestions for new types or changes to the existing types. > > The knowntypes are only used for validation (in acdvalid). We limit the > types to try to reuse the same names for matching input and output files > in different applications. > > We will add a "protein fasta" and a "sequence fasta" to the standards file. "Protein fasta" and "sequence fasta" were missing. stdout is less required because it should be the normal program output. But you should add a knowntype for stderr. > There is no problem with adding new knowntypes for your own > applications, but we like to know which ones are found to be useful so > we can make them official EMBOSS standard types too. > > regards, > > Peter Rice Thanks -- S?bastien Moretti SIB, Quartier Sorge - Genopode CH-1015 Lausanne, Switzerland Tel.: +41 (21) 692 4056/4221 From Sebastien.Moretti at unil.ch Fri Mar 28 14:18:03 2008 From: Sebastien.Moretti at unil.ch (Sebastien Moretti) Date: Fri, 28 Mar 2008 15:18:03 +0100 Subject: [EMBOSS] list and label values Message-ID: <47ECFE1B.30109@unil.ch> Hi, I am looking for a way to use labels/alias for values in a list: variable: matrixpath "/usr/molbio/share" list: matrix [ default: "$(matrixpath)/Hs.smat" minimum: 1 maximum: 1 values: "Human:$(matrixpath)/Hs.smat, Arabidopsis:$(matrixpath)/At.smat, Rat:$(matrixpath)/Rn.smat, Drosophila:$(matrixpath)/Dm.smat, Chicken:$(matrixpath)/Gga.smat, Mouse:$(matrixpath)/Mm.smat, Zebrafish:$(matrixpath)/Dr.smat" delimiter: "," codedelimiter: ":" comment: "defaults" prompt: "Score matrices file, species specific" information: "Score matrices file, species specific" ] So, when I select 'Human', I would like that "$(matrixpath)/Hs.smat" appears in command line. How could I do this ? Thanks -- S?bastien Moretti SIB, Quartier Sorge - Genopode CH-1015 Lausanne, Switzerland Tel.: +41 (21) 692 4056/4221 From pmr at ebi.ac.uk Fri Mar 28 15:38:32 2008 From: pmr at ebi.ac.uk (Peter Rice) Date: Fri, 28 Mar 2008 15:38:32 +0000 Subject: [EMBOSS] list and label values In-Reply-To: <47ECFE1B.30109@unil.ch> References: <47ECFE1B.30109@unil.ch> Message-ID: <47ED10F8.1050507@ebi.ac.uk> Sebastien Moretti wrote: > Hi, > > I am looking for a way to use labels/alias for values in a list: For those interested, I will reply on the emboss-dev list. This is a bit technical :-) Peter From Johanne.Duhaime at ircm.qc.ca Mon Mar 31 14:12:50 2008 From: Johanne.Duhaime at ircm.qc.ca (Duhaime Johanne) Date: Mon, 31 Mar 2008 10:12:50 -0400 Subject: [EMBOSS] EmbossExplorer: running problem (or installation problem?) Message-ID: Hello A while ago I sent a message asking for help. Someone guided me (I thank him a lot) but I am still struggling with the installation of Emboss Explorer. I have seeked for documentation but could not find any. I am using this forum since I do not know where else to apply. I wish this is OK. Here is my first question. "index.html" file in my Emboss web directory contains the following: EMBOSS Explorer in my "cgi-bin" I only have "emboss" as a perl program after the installation. How could that work? Of course if I rename emboss by, let's say intro (as in the index.html), it does work. But I have three frames. What am I missing? My second question I want to change the default output for "emma". For this I have put "SET emboss_OUTFORMAT clustal" in my "emboss.default" file. This work perfectly when I use "emma" at the command line. But it has no effect in the EmbossExplorer Interface. Is there a way to correct that? Thank you in advance for the help. It will be appreciate very much. Johanne Duhaime duhaimj at ircm.qc.ca